ID: 1109525580

View in Genome Browser
Species Human (GRCh38)
Location 13:63570464-63570486
Sequence CAGAACTAAGGAAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109525580_1109525584 8 Left 1109525580 13:63570464-63570486 CCTGACCACTTTCCTTAGTTCTG No data
Right 1109525584 13:63570495-63570517 TCTCCTATATAAAAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109525580 Original CRISPR CAGAACTAAGGAAAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr