ID: 1109525580 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:63570464-63570486 |
Sequence | CAGAACTAAGGAAAGTGGTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1109525580_1109525584 | 8 | Left | 1109525580 | 13:63570464-63570486 | CCTGACCACTTTCCTTAGTTCTG | No data | ||
Right | 1109525584 | 13:63570495-63570517 | TCTCCTATATAAAAGACTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1109525580 | Original CRISPR | CAGAACTAAGGAAAGTGGTC AGG (reversed) | Intergenic | ||
No off target data available for this crispr |