ID: 1109525584

View in Genome Browser
Species Human (GRCh38)
Location 13:63570495-63570517
Sequence TCTCCTATATAAAAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109525580_1109525584 8 Left 1109525580 13:63570464-63570486 CCTGACCACTTTCCTTAGTTCTG No data
Right 1109525584 13:63570495-63570517 TCTCCTATATAAAAGACTGCTGG No data
1109525583_1109525584 -4 Left 1109525583 13:63570476-63570498 CCTTAGTTCTGTAGGTTCTTCTC No data
Right 1109525584 13:63570495-63570517 TCTCCTATATAAAAGACTGCTGG No data
1109525582_1109525584 3 Left 1109525582 13:63570469-63570491 CCACTTTCCTTAGTTCTGTAGGT No data
Right 1109525584 13:63570495-63570517 TCTCCTATATAAAAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109525584 Original CRISPR TCTCCTATATAAAAGACTGC TGG Intergenic
No off target data available for this crispr