ID: 1109538076

View in Genome Browser
Species Human (GRCh38)
Location 13:63741427-63741449
Sequence AGCCAGCCCCTCTTCCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109538076_1109538078 -3 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538078 13:63741447-63741469 GCTCTCAGTCCCTGCCTCGCGGG 0: 28
1: 91
2: 111
3: 102
4: 330
1109538076_1109538079 -2 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538079 13:63741448-63741470 CTCTCAGTCCCTGCCTCGCGGGG 0: 30
1: 79
2: 120
3: 98
4: 203
1109538076_1109538085 21 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538085 13:63741471-63741493 GGTGCCTCCCGCCTCTGCGATGG No data
1109538076_1109538086 24 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538086 13:63741474-63741496 GCCTCCCGCCTCTGCGATGGTGG No data
1109538076_1109538080 -1 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538080 13:63741449-63741471 TCTCAGTCCCTGCCTCGCGGGGG 0: 30
1: 79
2: 108
3: 99
4: 198
1109538076_1109538077 -4 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538077 13:63741446-63741468 GGCTCTCAGTCCCTGCCTCGCGG 0: 41
1: 89
2: 98
3: 97
4: 261
1109538076_1109538081 0 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538081 13:63741450-63741472 CTCAGTCCCTGCCTCGCGGGGGG 0: 26
1: 76
2: 99
3: 106
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109538076 Original CRISPR AGCCAGCCCCTCTTCCCCAC TGG (reversed) Intergenic
No off target data available for this crispr