ID: 1109538077

View in Genome Browser
Species Human (GRCh38)
Location 13:63741446-63741468
Sequence GGCTCTCAGTCCCTGCCTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 41, 1: 89, 2: 98, 3: 97, 4: 261}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109538066_1109538077 23 Left 1109538066 13:63741400-63741422 CCCTCACTGAGATGGGGGTCCTA No data
Right 1109538077 13:63741446-63741468 GGCTCTCAGTCCCTGCCTCGCGG 0: 41
1: 89
2: 98
3: 97
4: 261
1109538067_1109538077 22 Left 1109538067 13:63741401-63741423 CCTCACTGAGATGGGGGTCCTAA No data
Right 1109538077 13:63741446-63741468 GGCTCTCAGTCCCTGCCTCGCGG 0: 41
1: 89
2: 98
3: 97
4: 261
1109538071_1109538077 4 Left 1109538071 13:63741419-63741441 CCTAAGAGCCAGTGGGGAAGAGG No data
Right 1109538077 13:63741446-63741468 GGCTCTCAGTCCCTGCCTCGCGG 0: 41
1: 89
2: 98
3: 97
4: 261
1109538076_1109538077 -4 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538077 13:63741446-63741468 GGCTCTCAGTCCCTGCCTCGCGG 0: 41
1: 89
2: 98
3: 97
4: 261
1109538065_1109538077 24 Left 1109538065 13:63741399-63741421 CCCCTCACTGAGATGGGGGTCCT No data
Right 1109538077 13:63741446-63741468 GGCTCTCAGTCCCTGCCTCGCGG 0: 41
1: 89
2: 98
3: 97
4: 261
1109538064_1109538077 27 Left 1109538064 13:63741396-63741418 CCTCCCCTCACTGAGATGGGGGT No data
Right 1109538077 13:63741446-63741468 GGCTCTCAGTCCCTGCCTCGCGG 0: 41
1: 89
2: 98
3: 97
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109538077 Original CRISPR GGCTCTCAGTCCCTGCCTCG CGG Intergenic
900416909 1:2539545-2539567 GCCACTCAGTGCCTGCCCCGGGG - Intergenic
900959438 1:5909778-5909800 AGTTCTCAGTCCCTGGCTCCAGG - Intronic
901445613 1:9306153-9306175 TGCCCTCAGTCCCTGCCCTGTGG - Intronic
901468074 1:9436011-9436033 GGCCCTCTGTCCATGCCTGGAGG - Intergenic
902440815 1:16428726-16428748 GGGTCTCAGTCACTGGCTCCAGG - Intronic
902590396 1:17469751-17469773 GGCTCACTGTCTCTGCCTCCTGG - Intergenic
902898527 1:19496641-19496663 GACTCACAGTCCCTGCCTCAAGG - Intergenic
902983816 1:20143404-20143426 TGCTCTGAGCCCCTGCCCCGGGG - Intronic
904267244 1:29325100-29325122 GGCTCTCTGCCCCTCCCTCGTGG + Intronic
904318559 1:29681718-29681740 GACATTCAGTCCCTGCCTCCAGG - Intergenic
904438929 1:30517265-30517287 GACATTCAGTCCCTGCCTCCAGG + Intergenic
905446547 1:38031397-38031419 GTCTCACAGTCCCTGCCTTGAGG - Intergenic
905882064 1:41470394-41470416 GTCTCTCAGTCCTTCCCTCCAGG - Intergenic
906128814 1:43443608-43443630 GGCTCCCAGACCCTGACTCAGGG - Exonic
906263153 1:44407902-44407924 AGCTCTGAGCCCCTGCCCCGCGG + Intronic
909720395 1:78761540-78761562 TGCTTTAAGTTCCTGCCTCGTGG - Intergenic
912695871 1:111841985-111842007 GCTTCTCAGACCCTGCCTCTAGG + Intronic
913063248 1:115226757-115226779 GGCTCACAGGCCCTTCCTTGGGG + Intergenic
913237310 1:116796093-116796115 GGCTCTGAGACCCTGCCAGGTGG - Intergenic
915552336 1:156642356-156642378 GCCTGTCAGCCCTTGCCTCGAGG + Intronic
916842223 1:168612588-168612610 GGCTCTCAGGCCATGCTTTGGGG - Intergenic
919900679 1:202042210-202042232 GGTGCTCAGTCCCTGCCTTGTGG + Intergenic
920193547 1:204211294-204211316 AGCTCACAGGCCCTGCCTGGTGG + Intronic
923942661 1:238844825-238844847 GACTCTCAGTCCCCGTGTCGTGG + Intergenic
924453365 1:244198879-244198901 GGCTCTCAGAACCTGGCTCTGGG - Intergenic
924593634 1:245426721-245426743 GGCTCCCAGGCCCTGCCTTCAGG + Intronic
1062970673 10:1645933-1645955 TGCTGTCTGTCCCTGCCTGGTGG + Intronic
1063611966 10:7570292-7570314 GGCTCTCAGTGCCTGCGTGCAGG - Intronic
1067712940 10:48664831-48664853 GGCTCTCAGTCCATGCTGTGTGG + Intergenic
1071578875 10:86752510-86752532 GGCTATCAGGCACTGCCTAGAGG - Intergenic
1073420288 10:103418922-103418944 GGCTTTCAGTGCCTGCCCCTTGG + Intronic
1075549814 10:123383849-123383871 TGCTCTCAGTCCTGGCCTCCAGG - Intergenic
1075711295 10:124532072-124532094 GGCTGCCAGTGCCTGCGTCGGGG - Intronic
1075943455 10:126411008-126411030 GGCTCTCAGTCACTGCCAGCAGG + Intergenic
1076260438 10:129060648-129060670 CTCTCTCAGTCCTTGCCTCTGGG - Intergenic
1076686087 10:132199082-132199104 GACCCTGAGTCCCTGCATCGGGG + Intronic
1076686098 10:132199115-132199137 GACCCTGAGTCCCTGCATCGGGG + Intronic
1077333297 11:1992840-1992862 GGCTCCCAGCCCCCGCCCCGGGG + Intergenic
1077576383 11:3387004-3387026 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1077576413 11:3387085-3387107 GGTTCTTACTCCCTGCATCGCGG + Intergenic
1077576506 11:3387472-3387494 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1078179979 11:9003626-9003648 GGCTCGCGGTCGCTGCGTCGCGG - Intronic
1081734617 11:45394267-45394289 CACTCTCATTCCCTTCCTCGTGG - Intergenic
1081868641 11:46373056-46373078 GGTCCTCAGGCCCTGCCTCGGGG - Exonic
1082258687 11:50060987-50061009 GGCTCTCAGGCCATGCATCTTGG - Intergenic
1083632720 11:64104049-64104071 CGCTCACATTCCCTGCCCCGTGG - Exonic
1083726173 11:64629680-64629702 GGCACTCAGTCCCTGCTTGCAGG - Intronic
1083780779 11:64916275-64916297 GGCTCAGTGTCCCTGCCTGGAGG - Intronic
1084014753 11:66371790-66371812 GACCCTCTGTCCCCGCCTCGGGG - Exonic
1084264066 11:67996015-67996037 GGCTCTTACTCCCCGCATCGTGG + Intronic
1084264094 11:67996095-67996117 GGCTCTTACTCCCCGCATCGCGG + Intronic
1084311216 11:68317366-68317388 GGCTCTCAGTCACACCCTCGGGG - Intronic
1084723408 11:70924282-70924304 GGAGCTCAGTCCGTGCCTCCTGG + Intronic
1084806755 11:71584550-71584572 GGCTCTTACTCCCCGCATCGCGG - Intronic
1084808963 11:71600716-71600738 GGCTCTTACTCCCCGCATCGCGG - Intronic
1084809246 11:71602789-71602811 GGCTCTTACTCCCCGCATCGCGG - Intronic
1084809271 11:71602869-71602891 GGCTCTTACTCCCCGCATCGCGG - Intronic
1084843972 11:71884956-71884978 GGCTCTTACTCCCTGCATCGTGG - Intronic
1084846810 11:71907357-71907379 GGCTCTTACTCCCCGCATCGCGG - Intronic
1084846838 11:71907437-71907459 GGCTCTTACTCCCCGCATCGTGG - Intronic
1085722640 11:78926346-78926368 GGCTCACTGTCTCTGCCTCCCGG + Intronic
1085855234 11:80168779-80168801 TTCTCTCAGTACCTGCCTCTGGG - Intergenic
1086439637 11:86815235-86815257 GCCCCTCAGCCCCTTCCTCGGGG + Intronic
1088908097 11:114169971-114169993 GGCTCTAAGTCTCTGCCAGGTGG - Intronic
1089750569 11:120648406-120648428 GGATCTCAGGCCCTCCCTCAGGG - Intronic
1090029409 11:123194778-123194800 GCTTTTCAGTCCCTGCCTCCTGG - Intronic
1090838823 11:130472584-130472606 GGATCTGCGTCCCTGCCTCCAGG + Intronic
1202816277 11_KI270721v1_random:48021-48043 GGCTCCCAGCCCCCGCCCCGGGG + Intergenic
1092134945 12:6140443-6140465 GGCACACATTCCTTGCCTCGTGG - Intergenic
1092433055 12:8424248-8424270 GGCTCTTACTCCCTGCATCGCGG + Intergenic
1092436271 12:8449203-8449225 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1092537305 12:9402647-9402669 GGCTCTCAGTCTCCGCCTCGCGG - Intergenic
1092537333 12:9402725-9402747 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1092537431 12:9403042-9403064 GGCTCTCAGTTCCCGCCTGGCGG - Intergenic
1092537559 12:9403442-9403464 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1092537591 12:9403523-9403545 GGCTCTCAGTCCCCACCTCGCGG - Intergenic
1092537778 12:9404025-9404047 TGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1092537864 12:9404286-9404308 GGCTCTCCGTCCCTGCCTCGCGG - Intergenic
1092537968 12:9404632-9404654 GACACTCTGTCCCCGCCTCGCGG - Intergenic
1092538020 12:9404792-9404814 GGCTCTCAGAACCTGGCTCGCGG - Intergenic
1092538042 12:9404871-9404893 TTCTCTCAGTCTCTGCCTCGCGG - Intergenic
1092538072 12:9404950-9404972 GCCTCTCAGTCCCCGCCTCGCGG - Intergenic
1092538102 12:9405028-9405050 GGCTCTCAGTCCCCGCCCCGTGG - Intergenic
1092538127 12:9405107-9405129 GGCTCTCAGTCCCAGCCTCCTGG - Intergenic
1092538413 12:9405825-9405847 GGCTCGCAGTCCCCGACTCGTGG - Intergenic
1092538446 12:9405904-9405926 GTCTCTCAGTCCCCGCCTCGCGG - Intergenic
1092538478 12:9405986-9406008 GGCTCTCAGTCCCCGCCCCGTGG - Intergenic
1092538506 12:9406066-9406088 GGCTCTCAGTCCCGGCCTCCTGG - Intergenic
1092538554 12:9406223-9406245 GGCTCTCAGTCCCCGCCTCGTGG - Intergenic
1092538620 12:9406510-9406532 GGCTCTCAGTCCCTGCCTCGCGG - Intergenic
1092538675 12:9406670-9406692 GGCTCTCCGTCCCTGCCTCGCGG - Intergenic
1092538720 12:9406826-9406848 GGCTCTCAGTCCCTGCCTCACGG - Intergenic
1092538768 12:9406984-9407006 GACTCTCCGTCCCCGCCTCGTGG - Intergenic
1092538802 12:9407064-9407086 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1092538825 12:9407144-9407166 TTCTCTCAGTCTCTGCCTCGCGG - Intergenic
1092538852 12:9407224-9407246 GGCTCTCAGTCCGTGCCTCACGG - Intergenic
1092539103 12:9408636-9408658 GGCACTCAGTCCCCGCCTCGCGG - Intergenic
1092556342 12:9566349-9566371 GGCTCTCAGTCCCCGCCTCACGG - Intergenic
1092556575 12:9567695-9567717 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1092556606 12:9567775-9567797 GGCTCTCAGTCACTGCCTCGTGG + Intergenic
1092556632 12:9567854-9567876 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1092556887 12:9569264-9569286 GGCTCTCAGTCCCCGCCTCACGG + Intergenic
1092556986 12:9569580-9569602 GGCTCTCAGTCCGCGCCTCACGG + Intergenic
1092557012 12:9569660-9569682 TTCTCTCAGTCTCTGCCTCGCGG + Intergenic
1092557101 12:9569940-9569962 GGCTGTCAGTCCCCGCCTCGCGG + Intergenic
1092557163 12:9570121-9570143 GGCTCTCAGTCCCCGCCCCGTGG + Intergenic
1092557191 12:9570201-9570223 GGCTCTCAGTCCCCACCTCGCGG + Intergenic
1092557288 12:9570411-9570433 GGCTTTCAGTCCCTGCCTCGCGG + Intergenic
1092557346 12:9570573-9570595 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1092557374 12:9570651-9570673 GGCTCTCAGTCTCCGCCTCGCGG + Intergenic
1094513904 12:31117258-31117280 GGCTCTCAGTCTCCCCCTCGCGG - Intergenic
1094514026 12:31117702-31117724 GGTTCTCAGTCCTCGCCTCGCGG - Intergenic
1094514077 12:31117861-31117883 CTCTCTCAGTCCCCGCCTCGCGG - Intergenic
1094514102 12:31117939-31117961 GGCTCTCAGTCCTCGCCTGGCGG - Intergenic
1094514127 12:31118018-31118040 GGCTCTCAGTTCCCGCCTTGCGG - Intergenic
1094514152 12:31118097-31118119 GGCTCTCAGTCCCCGCTTCGCGG - Intergenic
1094514236 12:31118334-31118356 GGCTCTCAGTCCCCGCCTCGTGG - Intergenic
1094514263 12:31118413-31118435 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1094514303 12:31118570-31118592 GGCTCTCAGTCCCCGTCTCTCGG - Intergenic
1094514337 12:31118650-31118672 GGCTCTCGATCCCCGCCTCTCGG - Intergenic
1094514388 12:31118812-31118834 GGCTCTCAGTCCCCGACTCGTGG - Intergenic
1094514454 12:31119099-31119121 GGCTCTCAGTTCCCGCCTCGCGG - Intergenic
1094514472 12:31119177-31119199 GGCTCTCAGTCCGCGCCTCGCGG - Intergenic
1094514528 12:31119337-31119359 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1094514580 12:31119495-31119517 GGCTCTCAGTCCCTGCCTCGCGG - Intergenic
1094514606 12:31119575-31119597 TGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1094514691 12:31119815-31119837 GGCTCTCCGTCCCTGCCTCTCGG - Intergenic
1094514731 12:31119970-31119992 GGCTGTCAGTCCCTGCCTGGCGG - Intergenic
1094514780 12:31120127-31120149 GACTCTCCGTCCCCGCCTCGCGG - Intergenic
1094514804 12:31120207-31120229 GTCTCTCAGTCCCCGCGTCGCGG - Intergenic
1094514951 12:31120735-31120757 GGCTCTCAGTTCCCGCCTTGGGG - Intergenic
1094514981 12:31120814-31120836 GGCTCTCAGTCCCCGCTTCGCGG - Intergenic
1094515039 12:31120976-31120998 GGCTCTCACTCCCCGCCTCGCGG - Intergenic
1094515071 12:31121055-31121077 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1094515333 12:31122468-31122490 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1094515364 12:31122548-31122570 GGCTCTCAGTCCCCCCCTCGCGG - Intergenic
1094515399 12:31122627-31122649 GACTCTCAGTCCCCGCCTCGAGG - Intergenic
1094515425 12:31122706-31122728 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1094515453 12:31122785-31122807 GTCTCTCAGTCCCTGCCTCGCGG - Intergenic
1094515482 12:31122864-31122886 GGCTCTCAATCCCCACCTCACGG - Intergenic
1094515512 12:31122943-31122965 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1094515751 12:31124307-31124329 GGCTCTCAGTCCCCGCCTCACGG + Intergenic
1095989985 12:48027840-48027862 GGGGCCCAGTCCCTGCCTCCAGG - Intergenic
1097815239 12:64066776-64066798 GGCTCTCAAACGCTGCCTCAAGG - Intronic
1099335559 12:81352320-81352342 GGCTCTCTGTTCCTGGCTCCAGG + Intronic
1100875014 12:98952584-98952606 GGCGATCAATACCTGCCTCGTGG + Intronic
1106755755 13:32821401-32821423 GGCTCCCAGTGCCTGCCTTGGGG - Intergenic
1107545157 13:41428003-41428025 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1107545186 13:41428085-41428107 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1107787345 13:43969704-43969726 GGTCCTCAGGCCCTGCCTCGGGG - Intergenic
1107940209 13:45376520-45376542 GGCTCTCAGTCCCTACCTCGTGG + Intergenic
1107940404 13:45377359-45377381 GGCTCTCAGTCCCCGCCTCGTGG + Intergenic
1107940485 13:45377596-45377618 GGCTCTCAGTCCCCACCTCGTGG + Intergenic
1107940510 13:45377675-45377697 GCCTCTGCGTCCCTGCCTCGTGG + Intergenic
1107940537 13:45377755-45377777 GGCTCTCAGTCCCTGCCTCGTGG + Intergenic
1107940567 13:45377834-45377856 GGCTCTCAGTCCCCGCCTCGTGG + Intergenic
1107940628 13:45377991-45378013 GGCTCTCAGTCCGTGCCTGGCGG + Intergenic
1107941041 13:45380063-45380085 GGCTCTCAGTCCCCGCCTCGTGG + Intergenic
1107941099 13:45380220-45380242 GGCTCTCAGTCCCAGCCTCGTGG + Intergenic
1107941126 13:45380299-45380321 GCCTCTGAGTCCCTGCCTCGTGG + Intergenic
1107941157 13:45380378-45380400 GGCTCTCAGTCCCCGCCTCGTGG + Intergenic
1107941217 13:45380534-45380556 GGCTCTCAGTCCGTGCCTGGCGG + Intergenic
1107941379 13:45381279-45381301 GGCTCTCAGTCCCTGCCTCCCGG + Intergenic
1107941486 13:45381594-45381616 GCCTCTGAGTCCCTGCCTCGTGG + Intergenic
1107941516 13:45381679-45381701 GGCTCTCAGTCCCTGCCTCACGG + Intergenic
1107941545 13:45381760-45381782 GGCTCTCAGTCCCCGCCTCGTGG + Intergenic
1107941601 13:45381918-45381940 GGCTCTCAGTCCCCGCCTCGTGG + Intergenic
1107941629 13:45381997-45382019 GCCTCTGAGTCCCTGCCTCGTGG + Intergenic
1107941656 13:45382077-45382099 GGCTCTCAGTCCCTGCCTCGTGG + Intergenic
1107941686 13:45382156-45382178 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1107941743 13:45382313-45382335 GGCTCTCAGTCCCCGCCTCGTGG + Intergenic
1107941771 13:45382392-45382414 GCCTCTGAGTCCCTGCCTCGTGG + Intergenic
1107941798 13:45382472-45382494 GGCTCTGAGTCTCCGCCTCGCGG + Intergenic
1107942107 13:45383967-45383989 GGCTCTCAGTCCCTGCCTCGTGG + Intergenic
1108053011 13:46464116-46464138 GGCTCTCAGTCCCTGCCTCGTGG - Intergenic
1108053041 13:46464195-46464217 GGCTCTCAGTCCCTGCCTCGTGG - Intergenic
1108053163 13:46464509-46464531 GCCTCTGAGTCCCCGCCTCGTGG - Intergenic
1108053400 13:46465514-46465536 GGCTCTCAGTCCCCGCCACACGG - Intergenic
1108053429 13:46465593-46465615 GGCTCTCGGTCCCTGCCTCGTGG - Intergenic
1108053461 13:46465680-46465702 GGCTCTCAGTCCCTGCCTCGTGG - Intergenic
1108053834 13:46467350-46467372 GGCTCTCAGTCCCTGCCTCGTGG - Intergenic
1108053866 13:46467430-46467452 GCCTCTGCGTCCCTGCCTCGTGG - Intergenic
1108053894 13:46467509-46467531 GGCTCTCAGTCCCCGCCTCGTGG - Intergenic
1108292605 13:48976265-48976287 GGCCCTCAGTCCCAGCCTAACGG - Intronic
1108818212 13:54316129-54316151 GGCTCTTACTCCCTGTATCGCGG - Intergenic
1109537112 13:63737476-63737498 GGCTCTCAGTTCCCGCCTCGCGG + Intergenic
1109537142 13:63737560-63737582 GGCTGTCAGTCCCCGCCTCCCGG + Intergenic
1109537172 13:63737640-63737662 GGCTTTCAGTACCCGCCTCGCGG + Intergenic
1109537200 13:63737720-63737742 GGCTCTCTGTCCCCTCGTCGCGG + Intergenic
1109537478 13:63739079-63739101 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1109537513 13:63739161-63739183 GGCTGTCAGTCCCTCCCTCGTGG + Intergenic
1109537564 13:63739321-63739343 GGCTCTCAATCCCCGCCTCGCGG + Intergenic
1109537611 13:63739480-63739502 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1109537642 13:63739558-63739580 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1109537920 13:63740971-63740993 TGCTCTCAGTCCCTGTCTCACGG + Intergenic
1109537948 13:63741049-63741071 GGCTGTCAGTCCCTCCCTCGTGG + Intergenic
1109537977 13:63741129-63741151 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1109538027 13:63741288-63741310 AGCTCTGAGTTCCCGCCTCGCGG + Intergenic
1109538057 13:63741367-63741389 GGCTCTCACTCCTCGGCTCGCGG + Intergenic
1109538077 13:63741446-63741468 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1109538101 13:63741526-63741548 GGCACTCAGTCCCGGCCTCGTGG + Intergenic
1109538146 13:63741684-63741706 AGCTCTGAGTCCCCGCCTCGCGG + Intergenic
1109538200 13:63741842-63741864 GGCTCTCAGTCCCTTCCTCGCGG + Intergenic
1109538226 13:63741922-63741944 CGCTCTCAGTCGCCGCCTCGCGG + Intergenic
1109538276 13:63742079-63742101 AGCTCTGAGTCCCTGCCTCTCGG + Intergenic
1109545562 13:63837693-63837715 AGCTCTGAGTCCCTGCCTCTCGG - Intergenic
1109545611 13:63837850-63837872 CGCTCTCAGTAGCCGCCTCGCGG - Intergenic
1109545636 13:63837930-63837952 GGCTCTCAGTCCCTTCCTCGCGG - Intergenic
1109545664 13:63838009-63838031 GGCTCTCAGTCCCCGCCTCACGG - Intergenic
1109545818 13:63838755-63838777 GCCTCTCAGTCCCCGCCTCATGG - Intergenic
1109545873 13:63838917-63838939 GGCTGTCAGTCCCTCCCCCGTGG - Intergenic
1109545902 13:63838997-63839019 GGCTCTCAGTCCCCGCCTCTCGG - Intergenic
1109546181 13:63840411-63840433 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1109546215 13:63840489-63840511 GGCTCTCAGTCCCCGCCTCGTGG - Intergenic
1109546264 13:63840646-63840668 GGCTGTCAGTCCCCGCCTCGCGG - Intergenic
1109546290 13:63840723-63840745 GGCTGTCAGTCCCCGCCTCGCGG - Intergenic
1109546319 13:63840804-63840826 GGCTCTCAGTTCCTGCCTGGCGG - Intergenic
1109546341 13:63840883-63840905 GGTTCTCAGTCCCTGCCTCATGG - Intergenic
1109546366 13:63840962-63840984 GGCTCTCAATCCTCGGCTCGCGG - Intergenic
1109546395 13:63841042-63841064 GGCTGTCAGTACCCGCCTCGCGG - Intergenic
1109546423 13:63841119-63841141 GGCTCTCAGTCCCCGCTTCGCGG - Intergenic
1109546473 13:63841278-63841300 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1109546497 13:63841358-63841380 GGAACTCAGTCCCCGCCTCGTGG - Intergenic
1109546518 13:63841438-63841460 GGCTCTCAGTCCCCACCTCGCGG - Intergenic
1109546666 13:63842181-63842203 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1109546690 13:63842260-63842282 GGCTCTCAGTCCTCGGCTCGCGG - Intergenic
1109546717 13:63842339-63842361 AGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1109546739 13:63842417-63842439 GTCTCTCAGTCCCCGCCTCGTGG - Intergenic
1109546764 13:63842496-63842518 GGCTCTCAGTCCCTGCCTCGCGG - Intergenic
1109547066 13:63843988-63844010 GGCTCTCAGTCCCTGCCTCGCGG - Intergenic
1109547093 13:63844067-63844089 GGCTCTCTGTCCCCTCGTCGCGG - Intergenic
1109547116 13:63844145-63844167 GCAACTCAGTCCCCGCCTCGCGG - Intergenic
1109547136 13:63844225-63844247 GGCTCTTACTCCCTGCCTCGCGG - Intergenic
1109547185 13:63844383-63844405 GGCTCTCAGTCCCCGCCTCTCGG - Intergenic
1110891541 13:80704384-80704406 GGCTCTCAATCCCTGCCTCGCGG - Intergenic
1110891569 13:80704463-80704485 GGCTCTCAGTCCCCACCTCGCGG - Intergenic
1110891597 13:80704542-80704564 GGCACTCAGTTCCCGCCTTGCGG - Intergenic
1110891800 13:80705452-80705474 GGCTCTCAGTCCCCGCCTCGTGG - Intergenic
1110891820 13:80705532-80705554 GGCTCTCAGTACCCGCCTAGTGG - Intergenic
1110891949 13:80705924-80705946 GGCTCTGAGTCCCCGCCTCACGG - Intergenic
1110892009 13:80706082-80706104 TGCTCTCAGTCCCTACCTCATGG - Intergenic
1110892022 13:80706121-80706143 GGCTCTCAGTCCCCGCGTCGTGG - Intergenic
1110892050 13:80706201-80706223 GGCTCTCAGTCCCTGCCTCGCGG - Intergenic
1110892106 13:80706357-80706379 GGCTCTCAGTCCCCACCTTGCGG - Intergenic
1110892253 13:80707104-80707126 GGCTCTCAGTCCCCGCCTCACGG - Intergenic
1110892281 13:80707183-80707205 GGCTCTCAGTCCCTGCCTCGCGG - Intergenic
1110892308 13:80707263-80707285 GGCTCTCAGTCCACACCTCACGG - Intergenic
1110892390 13:80707504-80707526 GCCTCTCAGTCCCGGCCTCGCGG - Intergenic
1110892417 13:80707583-80707605 GGGTCTCAGTTCCCGCCTAGAGG - Intergenic
1110892498 13:80707824-80707846 GGCTCTCAGTACCCGCCTCGCGG - Intergenic
1112486837 13:99827626-99827648 CGCTCTCAGCCCCTGCCACCTGG + Intronic
1113370647 13:109722202-109722224 GGGTCTCAGTCGCTGACTGGAGG - Intergenic
1114704170 14:24708724-24708746 GGCTCTCTTTCCCTGATTCGGGG - Intergenic
1117037739 14:51744805-51744827 GGCTCTTACTCCCCGCATCGCGG - Intergenic
1117548895 14:56814416-56814438 GTCTCTCACTCCCTGCATTGCGG + Intergenic
1121009284 14:90510472-90510494 GGCTCTGAGGCCCTGGCTCCTGG - Intergenic
1121324308 14:93011151-93011173 GGCTCTCAGTGTCTGCCCTGTGG - Intronic
1121595081 14:95156739-95156761 GGCTCTCGGTCCCTCCCGGGAGG - Intronic
1121935125 14:98011625-98011647 GCCTCTCAGTACCTGCCTGGAGG - Intergenic
1122151716 14:99729414-99729436 GGCTCTCAGTCCATGCTGCATGG + Intergenic
1122389186 14:101368701-101368723 GGGTCCCAGTCCCTGCCTCAGGG - Intergenic
1122721645 14:103725617-103725639 GGCTCTCAGCCCCTGCCAGGAGG - Intronic
1123032151 14:105456955-105456977 GGCTCCCAGACCCTGCCCCAAGG - Intronic
1123038856 14:105482296-105482318 GCTTCTCTGTCCCTGCCTTGGGG + Intergenic
1124652948 15:31486319-31486341 GGGTATCAGTCCCTGCCTCATGG + Intronic
1125532345 15:40421915-40421937 GGTTCCCAGTCCCTGCCTGCCGG + Intronic
1125677753 15:41511729-41511751 GGCTCTCCGTCCGTCCCTTGGGG - Intronic
1125716875 15:41824349-41824371 TGCCCTCAGTCCCTTCCTCTTGG - Intronic
1128003651 15:64218017-64218039 GGCTCGCAATCTCTGCCTCCCGG + Intronic
1128684468 15:69673393-69673415 GCCTCTCAGCCCCATCCTCGGGG - Intergenic
1128806312 15:70533476-70533498 GGGTCCCAGTCACTGCCTCCTGG + Intergenic
1129844597 15:78762448-78762470 AGCTCTCAGGCCAGGCCTCGTGG + Exonic
1131079434 15:89522545-89522567 GTCTCTGAGGCTCTGCCTCGGGG - Intergenic
1131119860 15:89815130-89815152 GGCTCTGAGCCCCTCCCCCGCGG - Intronic
1131131625 15:89904088-89904110 GGCACTGAGTCCCAGCCTCCGGG - Intronic
1132299182 15:100765992-100766014 GGCTCTGAGCCCCTCCATCGGGG + Intergenic
1132863164 16:2081400-2081422 CCCGCTCAGCCCCTGCCTCGAGG - Intronic
1132986003 16:2768006-2768028 TGCTCTCTGTCCCTGCCCCTGGG + Exonic
1133076311 16:3283569-3283591 GGCGCTCGGTTCCTGCCTCGGGG + Exonic
1133234855 16:4382979-4383001 AGTTCTCAGTCCCAACCTCGGGG + Exonic
1133608955 16:7415205-7415227 GACACTCAGTTCCTGCCTCTGGG - Intronic
1134228204 16:12408494-12408516 GGGTCCCAGAACCTGCCTCGGGG + Intronic
1141148121 16:81546173-81546195 GGCTGCCATTCCCTGCCTCCTGG - Intronic
1141645289 16:85364236-85364258 GTCTCTCAGACCCTGCTTCCGGG + Intergenic
1142559660 17:802662-802684 GGTTCACAGGCCCTGCCTCGGGG - Intronic
1143122144 17:4615130-4615152 GGCTCTCAGCCTCTTCCTCCTGG + Intergenic
1144748891 17:17634584-17634606 GGATCTCAGCCTCTGCCTCCAGG - Intergenic
1145348052 17:22054390-22054412 GGATCTCAGTGCCTGGCTTGTGG - Intergenic
1147677502 17:42218383-42218405 GGCTCTCAGTCCCTCTGTGGTGG + Intronic
1147688539 17:42301200-42301222 GGCTCTCAGTCCCTCTGTGGTGG - Intronic
1148087574 17:45003638-45003660 GGATCGGAGTCCCTGCCTCTAGG + Intergenic
1148818534 17:50347047-50347069 GCCCCCAAGTCCCTGCCTCGAGG + Intronic
1149402623 17:56313537-56313559 GGCTCTCAGTCCTTTTCTCTTGG + Intronic
1150905567 17:69333092-69333114 GGCTCTCTGTTCCTTCCTGGAGG - Intergenic
1151210728 17:72542115-72542137 GGCTCTCAGGCTCTGACTCCAGG - Intergenic
1151966226 17:77433239-77433261 GGCTCTCCTTCCCTGCAACGTGG - Intronic
1152590904 17:81211532-81211554 GGCTTGCAGTCCCTGCCGCATGG - Intronic
1153275190 18:3360923-3360945 GGCACTCAGACTCCGCCTCGGGG - Intergenic
1158850956 18:61495646-61495668 GGGTCTCAGGCCCAGCCTCAAGG + Intronic
1162043836 19:7985863-7985885 GACTCTCAGACCCTGCCTTGTGG - Intronic
1162063581 19:8111306-8111328 GGGACTCAGTCCCTGACTTGGGG + Intronic
1162535461 19:11261181-11261203 AGCTCTCTGTTCCTGCCTCAGGG + Intronic
1162551631 19:11361398-11361420 CGCTGGCAGTCCCAGCCTCGTGG + Exonic
1162751233 19:12830536-12830558 CGCTAGCTGTCCCTGCCTCGGGG - Intronic
1165007486 19:32818645-32818667 GGCTCCCAGGCCCTGCCACGAGG - Intronic
1165740708 19:38203647-38203669 GGCTCTCAGTGACGGCCACGTGG + Intronic
1166001939 19:39882748-39882770 TGCTCTCTGTCCCTGCCCCTGGG + Intronic
1166004722 19:39898999-39899021 TGCTCTCTGTCCCTGCCCCTGGG + Intronic
1166219885 19:41357565-41357587 CTCTCTCAGACCCTGCCTCCCGG + Intronic
1167206249 19:48104661-48104683 GGCTCACATTGCCTGCCTTGGGG - Exonic
1167407721 19:49324762-49324784 GGCCATCAGTCCCTGCCTTTGGG - Intronic
1168247591 19:55121127-55121149 GTCTCTTAGTCTCTGCCTCCTGG - Intergenic
925573089 2:5332239-5332261 AGCTCTAAGTCCCTGCTTCCTGG - Intergenic
929435649 2:41926688-41926710 GGCCCTGAGTCTCTGCCTGGTGG - Intergenic
929606154 2:43235615-43235637 GGCTTTCAGTCCTTGCCTTAAGG - Intronic
931703135 2:64924909-64924931 GGCTCACAGCCTCTGCCTCCAGG + Intergenic
931703418 2:64926878-64926900 GGCTCACAGCCTCTGCCTCCAGG - Intergenic
932352155 2:71041443-71041465 GGCTCTTACTCCCCGCATCGTGG - Intergenic
932373578 2:71213942-71213964 GACTAACAGTCCCTGCCTTGTGG - Intronic
932741715 2:74295863-74295885 GGCTCCAAGTCCCTGCTTGGTGG - Intronic
932812400 2:74835577-74835599 AGCTCTCATTCCCCGCCTCGGGG + Intronic
933457234 2:82531062-82531084 GGCTCTTAGTCCCCGCATCGCGG + Intergenic
937059393 2:118970444-118970466 TGCTCTAAGTCCCTGGCTCTTGG - Intronic
937289796 2:120775514-120775536 GCCCCCCAGTGCCTGCCTCGGGG + Intronic
938478380 2:131636154-131636176 GGCCTTCAGTCCATGCCTCATGG + Intergenic
939992896 2:148892319-148892341 TGCTCTCATTCTCTGCCTCTTGG + Intronic
943842907 2:192602845-192602867 GGCTCTTACTCCCCGCATCGCGG - Intergenic
946043918 2:216805135-216805157 GGCTCTGAGTCCCTGCCCCAGGG + Intergenic
947735083 2:232450107-232450129 GCCTCCCACTTCCTGCCTCGTGG - Intergenic
1170438188 20:16351440-16351462 GCCTCTCAGTCACTGACACGTGG - Intronic
1170582755 20:17711466-17711488 GGCTCTCAGGCTCTGCTTCCAGG - Intronic
1170764955 20:19281967-19281989 GGCTTTCTGTCCTTGCCTGGTGG + Intronic
1171558013 20:26095866-26095888 GGATCTCAGTGCCTGGCCCGTGG - Intergenic
1173551558 20:43936489-43936511 GGCTCTCCCTCCCTGCATCATGG + Intronic
1173839474 20:46147985-46148007 GGTTCTCAGTCTCTGCTTCAGGG - Intergenic
1174277485 20:49414457-49414479 GGTTCCCAGTCCTTGCCTCATGG + Intronic
1175267564 20:57711676-57711698 CGCCCTCAGCCCCTGCCTTGAGG + Intergenic
1175336428 20:58199215-58199237 GGCTCCCACTCCCTGCCCCAAGG + Intergenic
1175756793 20:61535342-61535364 GGCCCTCAGGCTCAGCCTCGTGG + Intronic
1175931046 20:62493834-62493856 GGCACTCAGTCCATGCATGGAGG - Intergenic
1176652989 21:9566751-9566773 GGATCTCAGTGCCTGGCTTGTGG + Intergenic
1176717417 21:10364706-10364728 GGCTCACACTCCCTGCCTTTGGG + Intergenic
1178482678 21:32993315-32993337 GGCTCTTAGAACCTGCCTCAAGG - Intergenic
1178929117 21:36802165-36802187 GGCCCTCAGTCACTGCTTGGAGG - Intronic
1178959890 21:37056113-37056135 GGGTCTCAGTGCCTACCTCAAGG - Intergenic
1180012778 21:45062274-45062296 GGCTTTCATCCCCTGCCTCTGGG + Intergenic
1180075541 21:45459689-45459711 GGGCCTCACTCCCTTCCTCGTGG - Intronic
1180298643 22:11017626-11017648 GGCTCACACTCCCTGCCTTTGGG + Intergenic
1180600928 22:17015287-17015309 GGCTCACACTCCCTGCCTTTGGG - Intergenic
1180676001 22:17587047-17587069 GGCTCTCAATCCCTGCCCCTGGG - Intronic
1181234949 22:21443130-21443152 GGCTCTTTGTCCCTGCCTGGTGG + Intronic
1181810427 22:25400681-25400703 GGCTCTCAGTCACACCCTCAGGG + Intronic
1182522622 22:30892887-30892909 GCCTCTCAGTGCCTGGCTCCTGG - Intronic
1183098715 22:35570358-35570380 GGATGTGAGTCCCTGCCTTGGGG - Intergenic
1183116615 22:35697344-35697366 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1183451441 22:37898056-37898078 GTCTCTCAGTCCCTGGCAGGAGG + Intergenic
1184394364 22:44224205-44224227 GCCTGTCTGTCCCTGCCTCTCGG + Intergenic
1184814744 22:46861030-46861052 GGCTCACTGTCTCTGCCTCCCGG + Intronic
949883139 3:8676880-8676902 GGCTCTCTGTCCCCGCCTCACGG - Intronic
949883196 3:8677041-8677063 GGCTCGCAGTCCCCGCCTCCTGG - Intronic
949883221 3:8677121-8677143 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
949883471 3:8678505-8678527 GGCTCTCAGTCCCCGCCTCGCGG - Intronic
949883496 3:8678584-8678606 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
949883527 3:8678663-8678685 GGCTCTCAATCCCCGCCTCGCGG - Intronic
949883579 3:8678825-8678847 GGTTCTCAGTCCCCGCCTCGTGG - Intronic
949883606 3:8678907-8678929 GGCTCTCAGTCCCCGCCTGGCGG - Intronic
949883630 3:8678987-8679009 GGCTCTCAGTCCCCACCTCGCGG - Intronic
949883656 3:8679066-8679088 TGCTCTCAGTCCCCGCCTCGCGG - Intronic
949883682 3:8679143-8679165 GCCTCTCAGTCCCCGCCTCGCGG - Intronic
949883735 3:8679300-8679322 GGCTCTTAGTCCCCGCCTCATGG - Intronic
949883762 3:8679381-8679403 GGCTCTCAGTCCCCTCCTCCTGG - Intronic
949883795 3:8679461-8679483 GGTTCTCAGTCCCCGCCTCCCGG - Intronic
949884094 3:8681020-8681042 GGCTCTCAGTCCCCGCCACTTGG - Intronic
949884119 3:8681099-8681121 GGCTCTCAGAACCCGCCTCGCGG - Intronic
949884173 3:8681256-8681278 GGCTGTCAGTCCCTGCCTCACGG - Intronic
949884200 3:8681335-8681357 GGCTCTCAGTCCCCGAGCCGCGG - Intronic
949884253 3:8681492-8681514 GGCTCTCAGTCCCCGCCTCGTGG - Intronic
949884361 3:8681806-8681828 GGCTCTCAGTCCCCACCCTGCGG - Intronic
950437763 3:12991069-12991091 CCCTCTCACCCCCTGCCTCGGGG - Intronic
954115898 3:48466659-48466681 GGCTCGCAGGCCCTGCCCCCGGG + Exonic
954456792 3:50603945-50603967 GGCTCTAGGTCTCTGCCTCAGGG + Intergenic
955323468 3:57991789-57991811 GGGCCTCAGTTCCTACCTCGTGG + Intergenic
956765168 3:72478696-72478718 GCCTCTCAGCACCTGCCTCAGGG - Intergenic
956778956 3:72589532-72589554 TGCTCTGAGTCCCTGTCTCAGGG - Intergenic
957077295 3:75612073-75612095 GGCTTTCACTCCCTGCATCGCGG + Intergenic
957077326 3:75612156-75612178 GGCTCTCACTCCCCGCATCGCGG + Intergenic
961274465 3:125715998-125716020 GGCTCTGACTCCCTGCATAGCGG - Intergenic
961277403 3:125738631-125738653 GGCTCTTACTCCCCGCATCGCGG - Intergenic
961281151 3:125766639-125766661 GGCCCGCCATCCCTGCCTCGGGG - Intergenic
961877023 3:130031037-130031059 GGCTCTTACTCCCCGCATCGCGG + Intergenic
962010470 3:131386018-131386040 GTCTCTCAGTGCCTGCCTACTGG + Intronic
962947746 3:140187286-140187308 TGCTCTCAGCCTCTGCCTCTTGG + Intronic
966860416 3:184228633-184228655 GGCTCTCAGACTCTTCCTTGGGG + Intronic
968908412 4:3464799-3464821 GGCTGGCAGGCCCTGCCTCCTGG - Intronic
968989301 4:3898227-3898249 GGCTCTTACTCCCCGCATCGCGG + Intergenic
969022637 4:4148086-4148108 GGCTCTTATTCCCCGCATCGCGG + Intergenic
969025865 4:4171805-4171827 GGCTCTTACTCCTTGCATCGCGG + Intergenic
969469943 4:7381823-7381845 GGCTCTCTGGCCCTGGCTCCTGG - Intronic
969730880 4:8956920-8956942 GGCTCTTACTCCCCGCATCGCGG - Intergenic
969730912 4:8957001-8957023 GGCTCTTACTCCCCGCATCGCGG - Intergenic
969785034 4:9450829-9450851 GGCTCTTACTCCCCGCATCGCGG - Intergenic
969790500 4:9491106-9491128 GGCTCTTACTCCCCGCATCGCGG - Intergenic
969790527 4:9491189-9491211 GGCTCTTACTCCCCGCATCGCGG - Intergenic
969790842 4:9493342-9493364 GGCTCTTACTCCCCGCATCGCGG - Intergenic
969792745 4:9503263-9503285 GGCTCTTACTCCCCGCATCGCGG - Intergenic
969826010 4:9758884-9758906 GGCTCTTACTCCCCGCGTCGCGG - Intergenic
972710305 4:41588774-41588796 GGCTCTCGGTCTCTGCCATGTGG - Intronic
985571510 5:648190-648212 ATCTCACAGTCCATGCCTCGTGG - Intronic
985571534 5:648372-648394 ATCTCACAGTCCATGCCTCGTGG - Intronic
985571600 5:648953-648975 ATCTCACAGTCCATGCCTCGTGG - Intronic
986314520 5:6577648-6577670 AGCTCTCAGCCCCTGCCCCATGG + Intergenic
986626977 5:9731401-9731423 GGATGTCAGTCCCTACCACGAGG - Intergenic
990905122 5:60795220-60795242 GTCTCTCAGTACCTTCCTCTCGG - Intronic
999144954 5:149386261-149386283 GGCTCTCAGCACCTGGCTCAGGG + Intronic
1001436332 5:171702550-171702572 GGCCCCCAGACCCTGCCCCGGGG + Intergenic
1002416645 5:179124312-179124334 GGCTCTCAGGCCCTGCCCCTAGG + Intronic
1003265881 6:4564805-4564827 GGGCCTCAGCCCCTGCCTCCAGG - Intergenic
1003298998 6:4859815-4859837 AGCTCTGAGTGGCTGCCTCGTGG + Intronic
1005264839 6:24100959-24100981 GGCTCTCTGTCCTTGGCTCCAGG - Intergenic
1006199139 6:32270724-32270746 GGCTCTCACTCCCCGCATCGCGG - Intergenic
1006516735 6:34549649-34549671 GGCTCTCAGGCCCTACCTCCTGG + Intronic
1013230413 6:108157407-108157429 GGATCTCAGCCCCTGCCTGTAGG + Intronic
1015195804 6:130523723-130523745 GGCTCTCAGTCTCTGTATCTGGG - Intergenic
1015815368 6:137205350-137205372 AGCTCTCAGACCCTGACTCCTGG - Intronic
1018079964 6:160250824-160250846 GGCTATCAGTCTGTGCCTCCTGG - Intronic
1018655117 6:166026946-166026968 AGCTCTCAGACTCTGCCTCCAGG - Intergenic
1019418208 7:936968-936990 GGCTCTGAGTCACTGCCAGGAGG + Intronic
1024228228 7:47344700-47344722 GGCACTCAGGCGCTGCATCGCGG - Intronic
1028613127 7:92734423-92734445 AGCTCTCTGGCCCTGCCTCCTGG + Intronic
1034303173 7:150033653-150033675 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034303226 7:150033814-150033836 GGCTCTCAGTCCCTGCCTCGTGG + Intergenic
1034303281 7:150033971-150033993 CGTTCGCAGTCCCCGCCTCGGGG + Intergenic
1034303309 7:150034050-150034072 GGCTCTGAGTCCCCGCCTCGCGG + Intergenic
1034303458 7:150034793-150034815 GGCTCTCAGTCCCCGCCTCGTGG + Intergenic
1034303485 7:150034873-150034895 GGCTCTCAGTCCCTACCTCGCGG + Intergenic
1034303573 7:150035181-150035203 GGCTCTCAGTCCCCGCCTCACGG + Intergenic
1034303602 7:150035262-150035284 GGCTCTCAGTCCCTGCCTCGTGG + Intergenic
1034303655 7:150035424-150035446 GGCTCTCAGTCCCTGACTCGCGG + Intergenic
1034303735 7:150035729-150035751 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1034303762 7:150035810-150035832 GGCTCTCAGTCCCTGCCTTGCGG + Intergenic
1034303816 7:150035972-150035994 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034303868 7:150036130-150036152 GGCTCTGAGTCCCCGCCTCGTGG + Intergenic
1034304022 7:150036881-150036903 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1034304050 7:150036962-150036984 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034304108 7:150037124-150037146 GGCTCTCAGTCCCTGCCTCGTGG + Intergenic
1034304167 7:150037350-150037372 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1034304194 7:150037431-150037453 GGCTCTCAATCCCTGCCTCGCGG + Intergenic
1034304316 7:150037819-150037841 GGCACTCAGTCCCTGCCTCGCGG + Intergenic
1034304366 7:150037977-150037999 GGTTCGCAGTCCCCGCCTCGCGG + Intergenic
1034304393 7:150038056-150038078 GGCTCTGAGTCCCCACCTCGCGG + Intergenic
1034304539 7:150038778-150038800 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1034304569 7:150038859-150038881 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034304653 7:150039168-150039190 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1034304683 7:150039249-150039271 GGCTCTCAATCTCTGCCTCGGGG + Intergenic
1034304738 7:150039409-150039431 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034304861 7:150039795-150039817 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034304911 7:150039953-150039975 GGTTCGCAGTCCCCGCCTCGCGG + Intergenic
1034304935 7:150040032-150040054 GGCTCTGAGTCCCCGCCTCGCGG + Intergenic
1034305084 7:150040778-150040800 GGCTCTCAGTCCCCGCCTTGCGG + Intergenic
1034305229 7:150041525-150041547 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1034305259 7:150041606-150041628 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034305319 7:150041769-150041791 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034305404 7:150042076-150042098 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034305433 7:150042157-150042179 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034305492 7:150042319-150042341 GGCTCTCAGTCCCTGCCTCGCGG + Intergenic
1034305542 7:150042477-150042499 GGTTCGCAGTCCCCGCCTCGCGG + Intergenic
1034305568 7:150042556-150042578 GGCTCTGAGTCCCCGCCTCGCGG + Intergenic
1034305716 7:150043302-150043324 GGCTCTCAGTCCCCGCCTTGCGG + Intergenic
1034629956 7:152523126-152523148 TGTCCTCAGTCCCTTCCTCGGGG - Intergenic
1034801127 7:154057348-154057370 GGCTCTCAGTCCCCGCCTCGCGG - Intronic
1034801276 7:154058096-154058118 GGCTCTGAGTCCCCGCCTCATGG - Intronic
1034801306 7:154058176-154058198 GGTTCGCAGTCCCCGCCTCGCGG - Intronic
1034801359 7:154058334-154058356 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
1034801412 7:154058495-154058517 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
1034801441 7:154058576-154058598 GGCTCTCAGTCCCCGCCTCGCGG - Intronic
1034801553 7:154058964-154058986 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
1034801581 7:154059044-154059066 GGCTCTCAGTCCCCGCCTCGTGG - Intronic
1034801634 7:154059206-154059228 GGCTCTCAGTCCCTACCTCGCGG - Intronic
1034801661 7:154059286-154059308 GGCTCTCAGTCCCCGCCTCAAGG - Intronic
1034801811 7:154060028-154060050 GGCTCTGAGTCCCCGCCTCGCGG - Intronic
1034801891 7:154060264-154060286 GCCTCTCAGTCCCTGCCTCGCGG - Intronic
1034801919 7:154060344-154060366 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
1034801949 7:154060425-154060447 GGCTCGCAGTCCCCGCCTCGCGG - Intronic
1034802033 7:154060732-154060754 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
1034802059 7:154060812-154060834 GGCTCTCAGTCCCTGCCTCATGG - Intronic
1034802084 7:154060892-154060914 GGCTCTCAGTCCCCGCCTCGTGG - Intronic
1034802260 7:154061714-154061736 GGTTCGCAGTCCCCGCCTCGCGG - Intronic
1034802312 7:154061872-154061894 GCCTCTCAGTCCCTGCCTCGCGG - Intronic
1034802369 7:154062033-154062055 GGCTGTCAGTCCCTGCCTCGCGG - Intronic
1034802398 7:154062114-154062136 GGCTCTCAGTCCCCGCCTCGCGG - Intronic
1034802485 7:154062420-154062442 GGCTCTCAGTCCCTGCCTAGCGG - Intronic
1034802543 7:154062582-154062604 GGCTCTCAGTCCCTGCCTAGCGG - Intronic
1034802598 7:154062745-154062767 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
1034802628 7:154062826-154062848 GGCTCGCAGTCCCCGCCTCGCGG - Intronic
1034802740 7:154063215-154063237 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
1034802770 7:154063295-154063317 GGCTCTCAGTCCCCGCCTCATGG - Intronic
1034802820 7:154063456-154063478 GGCTCTCAGTCCCTGCCTCGCGG - Intronic
1034802871 7:154063616-154063638 GGCTCTCAGTCCCTGCCTCGTGG - Intronic
1034802899 7:154063696-154063718 GGCTCTCAGTCCCCACCTCACGG - Intronic
1034879379 7:154751755-154751777 TCCTATCCGTCCCTGCCTCGGGG - Intronic
1035345160 7:158192687-158192709 GGCTAACAGCACCTGCCTCGTGG + Intronic
1036833957 8:12043086-12043108 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1036855803 8:12289651-12289673 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1036904133 8:12693497-12693519 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1039559948 8:38504793-38504815 GGCTCCCAGTCCTTGCCAGGGGG - Intergenic
1046758184 8:117992744-117992766 GGCTCTCATTCCCTGCCAGGAGG + Intronic
1047769307 8:128017838-128017860 GGCTCTCACTCCTTGTGTCGGGG + Intergenic
1053736147 9:41104224-41104246 GGCTGTCAGTCCCCTCCTCGCGG - Intergenic
1053736205 9:41104605-41104627 TGCTCTCAGTCACCGCCTCGCGG - Intergenic
1053736232 9:41104685-41104707 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1053736258 9:41104765-41104787 GGCTCTGAGACCCCGCCTCGCGG - Intergenic
1053736285 9:41104844-41104866 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1053736575 9:41106695-41106717 GTCTCTCAGTCCCCGCCTCGCGG - Intergenic
1053736646 9:41106934-41106956 GACTCTGAGTCCTTGCCTCGCGG - Intergenic
1053736693 9:41107091-41107113 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1053736732 9:41107196-41107218 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1053736761 9:41107272-41107294 GGCTGTCAGTCCCCGCCACGCGG - Intergenic
1053736787 9:41107351-41107373 GGCTCTCAGTCCCCGCCTCACGG - Intergenic
1053736813 9:41107431-41107453 GGCTCTTAGACACCGCCTCGCGG - Intergenic
1053736838 9:41107509-41107531 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1053737007 9:41108338-41108360 GGCTCTCAGTCCCTGCCTCGCGG - Intergenic
1053737059 9:41108498-41108520 GGTTCTCAGTCCCCGCCTCGCGG - Intergenic
1053737087 9:41108578-41108600 GGCTCTCAGTCCACGCCTCGTGG - Intergenic
1053737117 9:41108657-41108679 GGCTCTCAGTCCCCTCCTCCCGG - Intergenic
1053737147 9:41108737-41108759 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1053737175 9:41108817-41108839 GGCTCTCAGTCCCCGCCTCGCGG - Intergenic
1053737206 9:41108899-41108921 GGCTCGCAGTCCCTGTCTCGCGG - Intergenic
1053737234 9:41108978-41109000 GCCTCTCAGTCCCCGCCTCGCGG - Intergenic
1054691115 9:68322341-68322363 GCCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054691143 9:68322420-68322442 GGCTCGCAGTCCCTGTCTCGCGG + Intergenic
1054691173 9:68322500-68322522 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054691201 9:68322580-68322602 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054691231 9:68322660-68322682 GGCTCTCAGTCCCCTCCTCCCGG + Intergenic
1054691261 9:68322739-68322761 GGCTCTCAGTCCACGCCTCGTGG + Intergenic
1054691289 9:68322819-68322841 GGTTCTCAGTCCCCGCCTCGCGG + Intergenic
1054691367 9:68323059-68323081 GGCTGTCAGTCCCTGCCTCGCGG + Intergenic
1054691535 9:68323888-68323910 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054691560 9:68323966-68323988 GGCTCTTAGACACCGCCTCGCGG + Intergenic
1054691586 9:68324046-68324068 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054691612 9:68324125-68324147 GGCTGTCAGTCCCCGCCACGCGG + Intergenic
1054691641 9:68324204-68324226 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054691678 9:68324309-68324331 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054691726 9:68324467-68324489 GACTCTGAGTCCTTGCCTCGCGG + Intergenic
1054691796 9:68324705-68324727 GTCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054692088 9:68326556-68326578 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054692115 9:68326635-68326657 GGCTCTGAGACCCCGCCTCGCGG + Intergenic
1054692142 9:68326715-68326737 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1054692169 9:68326795-68326817 TGCTCTCAGTCACCGCCTCGCGG + Intergenic
1054692227 9:68327176-68327198 GGCTGTCAGTCCCCTCCTCGCGG + Intergenic
1054843567 9:69769155-69769177 AGCTCTCATTTCCTGCCTCTTGG - Intergenic
1055454413 9:76459386-76459408 GGCTCTCAGCCAGTGCCCCGTGG + Intronic
1055639669 9:78309710-78309732 GGCTCTCATTCGCTGACTGGGGG + Intronic
1056864799 9:90219887-90219909 GGCTCTCAGTCCCCGCATCGCGG - Intergenic
1056918228 9:90762999-90763021 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1056918256 9:90763078-90763100 GGCTCTTACTCCCCGCATCGCGG + Intergenic
1056918286 9:90763156-90763178 GGCTCTTACTCCCCGCATCGTGG + Intergenic
1057192066 9:93093910-93093932 GGCTTTCAGTCCCTGCATGCAGG + Intergenic
1057520007 9:95752541-95752563 GCCTGGCAGTCCCTGCCCCGGGG - Intergenic
1057705083 9:97390240-97390262 GGTTCCCAGTCCCTACCTCAAGG + Intergenic
1057831484 9:98410382-98410404 GGCTTCCAGTCCCTGCCACAAGG - Intronic
1059102609 9:111484280-111484302 GGCGCTCCGGCCCCGCCTCGAGG - Intronic
1059430614 9:114248139-114248161 GGTTCCCAATGCCTGCCTCGAGG + Intronic
1061040428 9:128138438-128138460 TGCTCTCAGTCCCCGCCTCTCGG + Intergenic
1061040457 9:128138518-128138540 GGCTCTCAGTCCCCGCCTAGCGG + Intergenic
1061040484 9:128138598-128138620 GGCTCTCAGGCACCGCCTCGCGG + Intergenic
1061040512 9:128138676-128138698 GGCTCTCAGTCTCCGCCTCGCGG + Intergenic
1061040540 9:128138756-128138778 GGCTGTCAGTCCCCGCCTCGCGG + Intergenic
1061040565 9:128138835-128138857 GCCTCTCAGTCCCCGCCTCGTGG + Intergenic
1061040597 9:128138916-128138938 GGCTCTCAGTCCCCGCCTCGCGG + Intergenic
1061040649 9:128139072-128139094 GGCTCTCAGTCGCCGACTCCCGG + Intergenic
1061040703 9:128139233-128139255 GGCTCTGAGTCCCCGCCTCGCGG + Intergenic
1061040759 9:128139392-128139414 GGCTGTCAGTTCCCGCCTAGCGG + Intergenic
1061040784 9:128139472-128139494 GGCTCTCAGTCCACGCCTCGCGG + Intergenic
1061040808 9:128139552-128139574 GGCTCTCAGTCCCCGCCTCACGG + Intergenic
1061040836 9:128139634-128139656 GGCTGTCAGTCCCCGCCTCGCGG + Intergenic
1061040864 9:128139714-128139736 GGCTCCCAGTCCCCAACTCGCGG + Intergenic
1061040891 9:128139793-128139815 GGCTCTCAGTCCCTGCGTCGCGG + Intergenic
1061746915 9:132746790-132746812 AGCACTCAGTCTCTGCCTCGAGG + Intronic
1061889202 9:133608876-133608898 GGGTCTCAGTCTCCTCCTCGGGG + Intergenic
1062065158 9:134522694-134522716 GTCTCTCTGTCACTGCCTGGGGG + Intergenic
1062417144 9:136457311-136457333 GGCGCTCAGAACCTGCCTCTTGG - Intronic
1203630718 Un_KI270750v1:70292-70314 GGATCTCAGTGCCTGGCTTGTGG + Intergenic
1187017450 X:15344304-15344326 AACTCTCAGTCCCTGCCCTGGGG - Intergenic
1196778265 X:119360564-119360586 TGCTCACAGTCCCTTCCTGGAGG - Intergenic
1198184523 X:134240382-134240404 GGCTTTTAGTCACTGCCTAGGGG - Intronic
1200834149 Y:7716681-7716703 GGCTGTCTGTCCCTTCCTCCTGG - Intergenic