ID: 1109538078

View in Genome Browser
Species Human (GRCh38)
Location 13:63741447-63741469
Sequence GCTCTCAGTCCCTGCCTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 28, 1: 91, 2: 111, 3: 102, 4: 330}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109538067_1109538078 23 Left 1109538067 13:63741401-63741423 CCTCACTGAGATGGGGGTCCTAA No data
Right 1109538078 13:63741447-63741469 GCTCTCAGTCCCTGCCTCGCGGG 0: 28
1: 91
2: 111
3: 102
4: 330
1109538076_1109538078 -3 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538078 13:63741447-63741469 GCTCTCAGTCCCTGCCTCGCGGG 0: 28
1: 91
2: 111
3: 102
4: 330
1109538065_1109538078 25 Left 1109538065 13:63741399-63741421 CCCCTCACTGAGATGGGGGTCCT No data
Right 1109538078 13:63741447-63741469 GCTCTCAGTCCCTGCCTCGCGGG 0: 28
1: 91
2: 111
3: 102
4: 330
1109538064_1109538078 28 Left 1109538064 13:63741396-63741418 CCTCCCCTCACTGAGATGGGGGT No data
Right 1109538078 13:63741447-63741469 GCTCTCAGTCCCTGCCTCGCGGG 0: 28
1: 91
2: 111
3: 102
4: 330
1109538066_1109538078 24 Left 1109538066 13:63741400-63741422 CCCTCACTGAGATGGGGGTCCTA No data
Right 1109538078 13:63741447-63741469 GCTCTCAGTCCCTGCCTCGCGGG 0: 28
1: 91
2: 111
3: 102
4: 330
1109538071_1109538078 5 Left 1109538071 13:63741419-63741441 CCTAAGAGCCAGTGGGGAAGAGG No data
Right 1109538078 13:63741447-63741469 GCTCTCAGTCCCTGCCTCGCGGG 0: 28
1: 91
2: 111
3: 102
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109538078 Original CRISPR GCTCTCAGTCCCTGCCTCGC GGG Intergenic
900860081 1:5222823-5222845 GCTCTCTGGCCCTATCTCGCTGG - Intergenic
900959437 1:5909777-5909799 GTTCTCAGTCCCTGGCTCCAGGG - Intronic
901445612 1:9306152-9306174 GCCCTCAGTCCCTGCCCTGTGGG - Intronic
901935458 1:12623154-12623176 ACTCTCTGTCCCTGCCTCCCAGG - Intergenic
902277323 1:15349348-15349370 GCTAACAGTCCCTGCCTCATCGG + Intronic
902534900 1:17113949-17113971 GCTCACAGTCCCTGCATAGTTGG - Intronic
903355754 1:22746431-22746453 GCTCTCAGTTCCAGCCACTCTGG - Intronic
905641920 1:39595955-39595977 GCTGTCTGTCCCTCCCTCCCTGG + Intergenic
906263154 1:44407903-44407925 GCTCTGAGCCCCTGCCCCGCGGG + Intronic
907113787 1:51950772-51950794 GTTCTCATTACCTGCCTCCCTGG - Intronic
907385030 1:54120726-54120748 CCTCGCAGTCCCTGCAACGCGGG + Intergenic
910292459 1:85612724-85612746 GCTTTCTATCCCTGCCTTGCTGG - Intergenic
915909897 1:159908464-159908486 GTTCTCAGTCCTTGGCTTGCTGG - Intergenic
916173498 1:162019671-162019693 GCTCCCAGGCCCAGCCTCTCTGG + Intronic
916189710 1:162167100-162167122 GCACTAAGTCTCTGCCTCCCTGG + Intronic
919730976 1:200913382-200913404 GCACTCAGCCCCTTCCTCCCAGG - Intronic
919900680 1:202042211-202042233 GTGCTCAGTCCCTGCCTTGTGGG + Intergenic
920193548 1:204211295-204211317 GCTCACAGGCCCTGCCTGGTGGG + Intronic
921559143 1:216635773-216635795 GCTCGCTGTCCATGTCTCGCTGG - Intronic
923461664 1:234214350-234214372 CCTCTCAGTCCCGGCCTCCCCGG - Intronic
923469691 1:234279508-234279530 GCTCTCTGTCCCTCACTCTCTGG - Intronic
924658900 1:245998190-245998212 GCTATCAGCCCCTGCTTCGGTGG + Intronic
924779172 1:247131240-247131262 GCACTCACTCACTGCCTCCCTGG - Intronic
1063874733 10:10462287-10462309 GCTGTCAGTTCCAGCCTTGCAGG + Intergenic
1064301856 10:14129993-14130015 GTTCTCACTCCCTGCCTCCCAGG + Intronic
1067658643 10:48217013-48217035 GCTCTGAGACACTGCCTCCCTGG + Intronic
1069272221 10:66543166-66543188 GCAATCAATCCCTGCCTCCCAGG + Intronic
1069942589 10:71965324-71965346 GCTCACAGACCCTGGCACGCCGG - Intronic
1070305350 10:75235886-75235908 GCTCTCCGTGCCCGCCGCGCTGG - Exonic
1070960803 10:80498984-80499006 GCTCTCAGGCTCTGCCCTGCTGG - Intronic
1072800354 10:98388474-98388496 GCTCTGCATCCCTTCCTCGCTGG - Exonic
1073468209 10:103706745-103706767 GTTCTCAATCCCTGCCTGGCAGG + Intronic
1074755959 10:116624360-116624382 GCTCATAGTCCCTTCCTCCCAGG - Intronic
1075427993 10:122356915-122356937 GCTGCCAGTCACTGCCTTGCTGG + Intergenic
1075549813 10:123383848-123383870 GCTCTCAGTCCTGGCCTCCAGGG - Intergenic
1075911259 10:126127505-126127527 GCACCCAGTCCCTGCCTTCCTGG + Intronic
1076637456 10:131891651-131891673 GCTCTCTGTCCCTGAGTCTCTGG - Intergenic
1076757021 10:132577828-132577850 GCTCTCGGTTCCAGCCTCGTTGG + Intronic
1077043545 11:534942-534964 TCGCTCAGTCCCTGCTTCCCAGG - Intronic
1077576384 11:3387005-3387027 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1077576414 11:3387086-3387108 GTTCTTACTCCCTGCATCGCGGG + Intergenic
1077576507 11:3387473-3387495 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1081734616 11:45394266-45394288 ACTCTCATTCCCTTCCTCGTGGG - Intergenic
1083647792 11:64182903-64182925 GCTTTCCTTCCCTGCCTCCCAGG + Intergenic
1083672577 11:64307303-64307325 GCTCCCACTCGCTGCCTCCCAGG + Exonic
1084228380 11:67732023-67732045 GCTATTAGTCCCCGCATCGCGGG + Intergenic
1084228403 11:67732101-67732123 GCTATTAGTCCCCGCATCGCGGG + Intergenic
1084228424 11:67732179-67732201 GCTATTAGTCCCAGCATCGCGGG + Intergenic
1084262197 11:67986405-67986427 GCTCTTACTCCCCGCATCGCAGG + Intergenic
1084264095 11:67996096-67996118 GCTCTTACTCCCCGCATCGCGGG + Intronic
1084304401 11:68272102-68272124 GCTCTCAGGCCCCGCCTCCCCGG + Intergenic
1084806754 11:71584549-71584571 GCTCTTACTCCCCGCATCGCGGG - Intronic
1084808962 11:71600715-71600737 GCTCTTACTCCCCGCATCGCGGG - Intronic
1084809245 11:71602788-71602810 GCTCTTACTCCCCGCATCGCGGG - Intronic
1084843949 11:71884875-71884897 GCTCTTACTCCCAGCATCGCTGG - Intronic
1084843971 11:71884955-71884977 GCTCTTACTCCCTGCATCGTGGG - Intronic
1084846809 11:71907356-71907378 GCTCTTACTCCCCGCATCGCGGG - Intronic
1085299549 11:75450213-75450235 TCTCGCTGTCCCTTCCTCGCTGG - Intronic
1085722641 11:78926347-78926369 GCTCACTGTCTCTGCCTCCCGGG + Intronic
1085855233 11:80168778-80168800 TCTCTCAGTACCTGCCTCTGGGG - Intergenic
1088779975 11:113124466-113124488 GCTGTCAGCCCCTGCTTGGCTGG - Intronic
1089234379 11:117010593-117010615 GCTCCCAGTCCCTGCCACCATGG + Intronic
1090664441 11:128905448-128905470 GCTCCCGGTTCCTGCCGCGCTGG + Intronic
1090744375 11:129694703-129694725 GCTCTCAGTTCCTGCCGTGGAGG - Intergenic
1091009890 11:131990814-131990836 GAGCTCAGTCCCTGACTCACAGG - Intronic
1091776901 12:3190586-3190608 GCTCTCAGGCCCTGTTTTGCAGG - Intronic
1091822909 12:3490172-3490194 GGTCTCAGTCCTTGACTCGTAGG + Intronic
1092237971 12:6821731-6821753 CCCCTCAGTCCCGGCCTCCCAGG - Exonic
1092433056 12:8424249-8424271 GCTCTTACTCCCTGCATCGCGGG + Intergenic
1092436272 12:8449204-8449226 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1092537332 12:9402724-9402746 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1092537430 12:9403041-9403063 GCTCTCAGTTCCCGCCTGGCGGG - Intergenic
1092537456 12:9403121-9403143 GCTGTCAGTCCCTGCCTCGCTGG - Intergenic
1092537508 12:9403281-9403303 GCTCTCAGTCCCCGCCTCGCTGG - Intergenic
1092537534 12:9403363-9403385 GCTCTCAGTCCCCGCCTCACAGG - Intergenic
1092537558 12:9403441-9403463 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1092537590 12:9403522-9403544 GCTCTCAGTCCCCACCTCGCGGG - Intergenic
1092537777 12:9404024-9404046 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1092537863 12:9404285-9404307 GCTCTCCGTCCCTGCCTCGCGGG - Intergenic
1092537996 12:9404711-9404733 GCTGTCAGTCCCCGCCTCGCTGG - Intergenic
1092538019 12:9404791-9404813 GCTCTCAGAACCTGGCTCGCGGG - Intergenic
1092538041 12:9404870-9404892 TCTCTCAGTCTCTGCCTCGCGGG - Intergenic
1092538070 12:9404949-9404971 CCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1092538101 12:9405027-9405049 GCTCTCAGTCCCCGCCCCGTGGG - Intergenic
1092538126 12:9405106-9405128 GCTCTCAGTCCCAGCCTCCTGGG - Intergenic
1092538151 12:9405185-9405207 GCTCTCAGTCCCAGCCTTGTAGG - Intergenic
1092538412 12:9405824-9405846 GCTCGCAGTCCCCGACTCGTGGG - Intergenic
1092538445 12:9405903-9405925 TCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1092538477 12:9405985-9406007 GCTCTCAGTCCCCGCCCCGTGGG - Intergenic
1092538505 12:9406065-9406087 GCTCTCAGTCCCGGCCTCCTGGG - Intergenic
1092538529 12:9406144-9406166 GCTCTCAGTCCCAGCCTCGTAGG - Intergenic
1092538553 12:9406222-9406244 GCTCTCAGTCCCCGCCTCGTGGG - Intergenic
1092538619 12:9406509-9406531 GCTCTCAGTCCCTGCCTCGCGGG - Intergenic
1092538674 12:9406669-9406691 GCTCTCCGTCCCTGCCTCGCGGG - Intergenic
1092538719 12:9406825-9406847 GCTCTCAGTCCCTGCCTCACGGG - Intergenic
1092538801 12:9407063-9407085 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1092538824 12:9407143-9407165 TCTCTCAGTCTCTGCCTCGCGGG - Intergenic
1092538851 12:9407223-9407245 GCTCTCAGTCCGTGCCTCACGGG - Intergenic
1092539102 12:9408635-9408657 GCACTCAGTCCCCGCCTCGCGGG - Intergenic
1092556341 12:9566348-9566370 GCTCTCAGTCCCCGCCTCACGGG - Intergenic
1092556576 12:9567696-9567718 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1092556607 12:9567776-9567798 GCTCTCAGTCACTGCCTCGTGGG + Intergenic
1092556633 12:9567855-9567877 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1092556888 12:9569265-9569287 GCTCTCAGTCCCCGCCTCACGGG + Intergenic
1092556936 12:9569421-9569443 GCTCTCAGTCCCCGCCTCGCAGG + Intergenic
1092556987 12:9569581-9569603 GCTCTCAGTCCGCGCCTCACGGG + Intergenic
1092557013 12:9569661-9569683 TCTCTCAGTCTCTGCCTCGCGGG + Intergenic
1092557164 12:9570122-9570144 GCTCTCAGTCCCCGCCCCGTGGG + Intergenic
1092557192 12:9570202-9570224 GCTCTCAGTCCCCACCTCGCGGG + Intergenic
1092557289 12:9570412-9570434 GCTTTCAGTCCCTGCCTCGCGGG + Intergenic
1092557318 12:9570494-9570516 GCTCTCAGTCCCCGCCTCGCTGG + Intergenic
1092557347 12:9570574-9570596 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1093143830 12:15540914-15540936 TCTCTCATTCCATGCCTCTCCGG - Intronic
1094514025 12:31117701-31117723 GTTCTCAGTCCTCGCCTCGCGGG - Intergenic
1094514076 12:31117860-31117882 TCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1094514101 12:31117938-31117960 GCTCTCAGTCCTCGCCTGGCGGG - Intergenic
1094514151 12:31118096-31118118 GCTCTCAGTCCCCGCTTCGCGGG - Intergenic
1094514180 12:31118176-31118198 GCTCTCAGTCCCCGCCTCGCAGG - Intergenic
1094514205 12:31118255-31118277 GCTCTCAGTCCCCGCCTCTCCGG - Intergenic
1094514235 12:31118333-31118355 GCTCTCAGTCCCCGCCTCGTGGG - Intergenic
1094514262 12:31118412-31118434 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1094514302 12:31118569-31118591 GCTCTCAGTCCCCGTCTCTCGGG - Intergenic
1094514336 12:31118649-31118671 GCTCTCGATCCCCGCCTCTCGGG - Intergenic
1094514361 12:31118731-31118753 GCTCTCAGTGCCCGCCTCGCTGG - Intergenic
1094514387 12:31118811-31118833 GCTCTCAGTCCCCGACTCGTGGG - Intergenic
1094514553 12:31119414-31119436 GCTCTCAATCCTCGCCTCGCCGG - Intergenic
1094514579 12:31119494-31119516 GCTCTCAGTCCCTGCCTCGCGGG - Intergenic
1094514605 12:31119574-31119596 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1094514634 12:31119656-31119678 GCTCTCAGTTCCTGCCTCGCAGG - Intergenic
1094514690 12:31119814-31119836 GCTCTCCGTCCCTGCCTCTCGGG - Intergenic
1094514730 12:31119969-31119991 GCTGTCAGTCCCTGCCTGGCGGG - Intergenic
1094514779 12:31120126-31120148 ACTCTCCGTCCCCGCCTCGCGGG - Intergenic
1094514980 12:31120813-31120835 GCTCTCAGTCCCCGCTTCGCGGG - Intergenic
1094515010 12:31120895-31120917 GCTCTCAGTCCCCGCCTCTCAGG - Intergenic
1094515038 12:31120975-31120997 GCTCTCACTCCCCGCCTCGCGGG - Intergenic
1094515070 12:31121054-31121076 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1094515332 12:31122467-31122489 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1094515363 12:31122547-31122569 GCTCTCAGTCCCCCCCTCGCGGG - Intergenic
1094515398 12:31122626-31122648 ACTCTCAGTCCCCGCCTCGAGGG - Intergenic
1094515424 12:31122705-31122727 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1094515452 12:31122784-31122806 TCTCTCAGTCCCTGCCTCGCGGG - Intergenic
1094515481 12:31122863-31122885 GCTCTCAATCCCCACCTCACGGG - Intergenic
1094515511 12:31122942-31122964 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1094515752 12:31124308-31124330 GCTCTCAGTCCCCGCCTCACGGG + Intergenic
1095961154 12:47835046-47835068 GCTCACAGTCCTTGCCAGGCTGG + Intergenic
1096217954 12:49808876-49808898 GTTCCCAGACCCTGCCTGGCCGG - Intronic
1101853689 12:108424675-108424697 GCTCTCACTCCCTCCCTATCAGG + Intergenic
1103844419 12:123891613-123891635 CCTCTCAGTCTCTTCCTCCCGGG - Intronic
1104567284 12:129896367-129896389 GCTCTCATTCCCTGCTGCCCTGG - Intronic
1104892636 12:132147825-132147847 CCCCCCAGTCCCTGCCTCCCTGG - Intronic
1105755752 13:23462283-23462305 GCACTCAGGCCCTCCCTTGCTGG + Intergenic
1106098994 13:26678746-26678768 GCTCTCTGTCACTGCCACTCAGG + Intronic
1106193125 13:27471685-27471707 ACTCTCAGTCCCTGGTTAGCAGG - Intergenic
1107545158 13:41428004-41428026 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1107545187 13:41428086-41428108 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1107940210 13:45376521-45376543 GCTCTCAGTCCCTACCTCGTGGG + Intergenic
1107940371 13:45377280-45377302 GCTCTCAGTCCCCGCCTTGCTGG + Intergenic
1107940405 13:45377360-45377382 GCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1107940432 13:45377439-45377461 GCTCTCAGTCCCTGCCTTGTTGG + Intergenic
1107940461 13:45377517-45377539 GCTCTCAGTACCTGCCTCATTGG + Intergenic
1107940486 13:45377597-45377619 GCTCTCAGTCCCCACCTCGTGGG + Intergenic
1107940512 13:45377676-45377698 CCTCTGCGTCCCTGCCTCGTGGG + Intergenic
1107940538 13:45377756-45377778 GCTCTCAGTCCCTGCCTCGTGGG + Intergenic
1107940568 13:45377835-45377857 GCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1107940599 13:45377913-45377935 GCTCTCAGTCCCTGCCTCGTTGG + Intergenic
1107940629 13:45377992-45378014 GCTCTCAGTCCGTGCCTGGCGGG + Intergenic
1107941042 13:45380064-45380086 GCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1107941074 13:45380143-45380165 GCTCTCAGTCCCTGCCTCGTTGG + Intergenic
1107941100 13:45380221-45380243 GCTCTCAGTCCCAGCCTCGTGGG + Intergenic
1107941128 13:45380300-45380322 CCTCTGAGTCCCTGCCTCGTGGG + Intergenic
1107941158 13:45380379-45380401 GCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1107941188 13:45380456-45380478 GCTCTCAGTCCCTGCCTCGTTGG + Intergenic
1107941218 13:45380535-45380557 GCTCTCAGTCCGTGCCTGGCGGG + Intergenic
1107941380 13:45381280-45381302 GCTCTCAGTCCCTGCCTCCCGGG + Intergenic
1107941411 13:45381358-45381380 GCTCTCAGTCCCTGCCTCGTTGG + Intergenic
1107941457 13:45381516-45381538 GCTCTCAGTCCCCGCCTCGTAGG + Intergenic
1107941488 13:45381595-45381617 CCTCTGAGTCCCTGCCTCGTGGG + Intergenic
1107941517 13:45381680-45381702 GCTCTCAGTCCCTGCCTCACGGG + Intergenic
1107941546 13:45381761-45381783 GCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1107941576 13:45381839-45381861 GCTCTCAGTCCCTGCCTCGTTGG + Intergenic
1107941602 13:45381919-45381941 GCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1107941631 13:45381998-45382020 CCTCTGAGTCCCTGCCTCGTGGG + Intergenic
1107941657 13:45382078-45382100 GCTCTCAGTCCCTGCCTCGTGGG + Intergenic
1107941687 13:45382157-45382179 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1107941718 13:45382235-45382257 GCTCTCAGTCCCTGCCTCGTTGG + Intergenic
1107941744 13:45382314-45382336 GCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1107941773 13:45382393-45382415 CCTCTGAGTCCCTGCCTCGTGGG + Intergenic
1107941799 13:45382473-45382495 GCTCTGAGTCTCCGCCTCGCGGG + Intergenic
1107942108 13:45383968-45383990 GCTCTCAGTCCCTGCCTCGTGGG + Intergenic
1108053010 13:46464115-46464137 GCTCTCAGTCCCTGCCTCGTGGG - Intergenic
1108053040 13:46464194-46464216 GCTCTCAGTCCCTGCCTCGTGGG - Intergenic
1108053071 13:46464272-46464294 GCTCTCAGTCCCTGCCTTGTTGG - Intergenic
1108053098 13:46464350-46464372 GCTCTCGGTCCCTGCCTTGTTGG - Intergenic
1108053130 13:46464429-46464451 CCTCTGAGTCCCCGCCTCGTTGG - Intergenic
1108053161 13:46464508-46464530 CCTCTGAGTCCCCGCCTCGTGGG - Intergenic
1108053194 13:46464589-46464611 GCTCTCAGTCCCCACCTCGCTGG - Intergenic
1108053375 13:46465434-46465456 GCTTTCAGTCCCCGCCTCGCAGG - Intergenic
1108053399 13:46465513-46465535 GCTCTCAGTCCCCGCCACACGGG - Intergenic
1108053428 13:46465592-46465614 GCTCTCGGTCCCTGCCTCGTGGG - Intergenic
1108053460 13:46465679-46465701 GCTCTCAGTCCCTGCCTCGTGGG - Intergenic
1108053494 13:46465758-46465780 GCTCTCAGTCCCCGCCTCGCCGG - Intergenic
1108053808 13:46467269-46467291 GCTCTCAGTCCCCGCCTCGCAGG - Intergenic
1108053833 13:46467349-46467371 GCTCTCAGTCCCTGCCTCGTGGG - Intergenic
1108053864 13:46467429-46467451 CCTCTGCGTCCCTGCCTCGTGGG - Intergenic
1108053893 13:46467508-46467530 GCTCTCAGTCCCCGCCTCGTGGG - Intergenic
1108053918 13:46467588-46467610 GCTCTCAGTCCCTGCCTCGTTGG - Intergenic
1108586819 13:51877072-51877094 GTTCTCAATCCTTGCCTCTCAGG - Intergenic
1108818211 13:54316128-54316150 GCTCTTACTCCCTGTATCGCGGG - Intergenic
1109537143 13:63737561-63737583 GCTGTCAGTCCCCGCCTCCCGGG + Intergenic
1109537173 13:63737641-63737663 GCTTTCAGTACCCGCCTCGCGGG + Intergenic
1109537201 13:63737721-63737743 GCTCTCTGTCCCCTCGTCGCGGG + Intergenic
1109537479 13:63739080-63739102 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1109537514 13:63739162-63739184 GCTGTCAGTCCCTCCCTCGTGGG + Intergenic
1109537565 13:63739322-63739344 GCTCTCAATCCCCGCCTCGCGGG + Intergenic
1109537612 13:63739481-63739503 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1109537921 13:63740972-63740994 GCTCTCAGTCCCTGTCTCACGGG + Intergenic
1109537949 13:63741050-63741072 GCTGTCAGTCCCTCCCTCGTGGG + Intergenic
1109537978 13:63741130-63741152 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1109538028 13:63741289-63741311 GCTCTGAGTTCCCGCCTCGCGGG + Intergenic
1109538078 13:63741447-63741469 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1109538102 13:63741527-63741549 GCACTCAGTCCCGGCCTCGTGGG + Intergenic
1109538147 13:63741685-63741707 GCTCTGAGTCCCCGCCTCGCGGG + Intergenic
1109538201 13:63741843-63741865 GCTCTCAGTCCCTTCCTCGCGGG + Intergenic
1109538227 13:63741923-63741945 GCTCTCAGTCGCCGCCTCGCGGG + Intergenic
1109538277 13:63742080-63742102 GCTCTGAGTCCCTGCCTCTCGGG + Intergenic
1109538328 13:63742240-63742262 GTTCTCAGTCCCTGCCTCAGTGG + Intergenic
1109545511 13:63837532-63837554 GTTCTCAGTCCCTGCCTCAGTGG - Intergenic
1109545561 13:63837692-63837714 GCTCTGAGTCCCTGCCTCTCGGG - Intergenic
1109545610 13:63837849-63837871 GCTCTCAGTAGCCGCCTCGCGGG - Intergenic
1109545635 13:63837929-63837951 GCTCTCAGTCCCTTCCTCGCGGG - Intergenic
1109545663 13:63838008-63838030 GCTCTCAGTCCCCGCCTCACGGG - Intergenic
1109545816 13:63838754-63838776 CCTCTCAGTCCCCGCCTCATGGG - Intergenic
1109545872 13:63838916-63838938 GCTGTCAGTCCCTCCCCCGTGGG - Intergenic
1109546214 13:63840488-63840510 GCTCTCAGTCCCCGCCTCGTGGG - Intergenic
1109546263 13:63840645-63840667 GCTGTCAGTCCCCGCCTCGCGGG - Intergenic
1109546289 13:63840722-63840744 GCTGTCAGTCCCCGCCTCGCGGG - Intergenic
1109546318 13:63840803-63840825 GCTCTCAGTTCCTGCCTGGCGGG - Intergenic
1109546340 13:63840882-63840904 GTTCTCAGTCCCTGCCTCATGGG - Intergenic
1109546365 13:63840961-63840983 GCTCTCAATCCTCGGCTCGCGGG - Intergenic
1109546394 13:63841041-63841063 GCTGTCAGTACCCGCCTCGCGGG - Intergenic
1109546422 13:63841118-63841140 GCTCTCAGTCCCCGCTTCGCGGG - Intergenic
1109546472 13:63841277-63841299 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1109546496 13:63841357-63841379 GAACTCAGTCCCCGCCTCGTGGG - Intergenic
1109546517 13:63841437-63841459 GCTCTCAGTCCCCACCTCGCGGG - Intergenic
1109546689 13:63842259-63842281 GCTCTCAGTCCTCGGCTCGCGGG - Intergenic
1109546716 13:63842338-63842360 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1109546738 13:63842416-63842438 TCTCTCAGTCCCCGCCTCGTGGG - Intergenic
1109546763 13:63842495-63842517 GCTCTCAGTCCCTGCCTCGCGGG - Intergenic
1109547065 13:63843987-63844009 GCTCTCAGTCCCTGCCTCGCGGG - Intergenic
1109547092 13:63844066-63844088 GCTCTCTGTCCCCTCGTCGCGGG - Intergenic
1109547115 13:63844144-63844166 CAACTCAGTCCCCGCCTCGCGGG - Intergenic
1109547135 13:63844224-63844246 GCTCTTACTCCCTGCCTCGCGGG - Intergenic
1109547184 13:63844382-63844404 GCTCTCAGTCCCCGCCTCTCGGG - Intergenic
1110891540 13:80704383-80704405 GCTCTCAATCCCTGCCTCGCGGG - Intergenic
1110891568 13:80704462-80704484 GCTCTCAGTCCCCACCTCGCGGG - Intergenic
1110891596 13:80704541-80704563 GCACTCAGTTCCCGCCTTGCGGG - Intergenic
1110891649 13:80704703-80704725 GCTCTCAGTTCCCGCCTCACAGG - Intergenic
1110891799 13:80705451-80705473 GCTCTCAGTCCCCGCCTCGTGGG - Intergenic
1110891819 13:80705531-80705553 GCTCTCAGTACCCGCCTAGTGGG - Intergenic
1110891866 13:80705687-80705709 GCTCGCAGTCCCCACCTTGCAGG - Intergenic
1110891948 13:80705923-80705945 GCTCTGAGTCCCCGCCTCACGGG - Intergenic
1110891980 13:80706002-80706024 GCTCTTAGTCCCCACCTCGCTGG - Intergenic
1110892008 13:80706081-80706103 GCTCTCAGTCCCTACCTCATGGG - Intergenic
1110892021 13:80706120-80706142 GCTCTCAGTCCCCGCGTCGTGGG - Intergenic
1110892049 13:80706200-80706222 GCTCTCAGTCCCTGCCTCGCGGG - Intergenic
1110892074 13:80706279-80706301 TGGCTGAGTCCCTGCCTCGCGGG - Intergenic
1110892105 13:80706356-80706378 GCTCTCAGTCCCCACCTTGCGGG - Intergenic
1110892280 13:80707182-80707204 GCTCTCAGTCCCTGCCTCGCGGG - Intergenic
1110892307 13:80707262-80707284 GCTCTCAGTCCACACCTCACGGG - Intergenic
1110892360 13:80707423-80707445 GCTCTCAGTCCCCGCCTCGCAGG - Intergenic
1110892388 13:80707503-80707525 CCTCTCAGTCCCGGCCTCGCGGG - Intergenic
1110892469 13:80707744-80707766 GTTCTCAGTCCCCGCCTCGGAGG - Intergenic
1110892497 13:80707823-80707845 GCTCTCAGTACCCGCCTCGCGGG - Intergenic
1112486838 13:99827627-99827649 GCTCTCAGCCCCTGCCACCTGGG + Intronic
1113506662 13:110821392-110821414 GGTCCCAAGCCCTGCCTCGCGGG - Intergenic
1117037738 14:51744804-51744826 GCTCTTACTCCCCGCATCGCGGG - Intergenic
1117038035 14:51746932-51746954 GCTCTTACTCCCTGTATCGCAGG - Intergenic
1119535043 14:75396049-75396071 GCCCTCCGTCCCTGCCACTCAGG - Intergenic
1119769890 14:77213974-77213996 ACTCTCAGGCCCTCCATCGCAGG + Intronic
1121107267 14:91289210-91289232 GTCCTCAGACCCCGCCTCGCCGG - Exonic
1122023611 14:98859084-98859106 CTCCTCAGTCCCTGCCTTGCGGG - Intergenic
1122802624 14:104239268-104239290 CCCCTCAGGCCCTGTCTCGCAGG - Intergenic
1122978769 14:105181717-105181739 GCCCACAGTCCCTCCCTCCCTGG - Intergenic
1202922956 14_KI270724v1_random:2327-2349 GCCCTCGCTCCCTGGCTCGCAGG + Intergenic
1124121803 15:26894365-26894387 GTTCTCACTGCCGGCCTCGCGGG + Intronic
1124808708 15:32912323-32912345 GTTCTCAGTCCCAACCTCTCTGG - Intronic
1125532346 15:40421916-40421938 GTTCCCAGTCCCTGCCTGCCGGG + Intronic
1127683223 15:61317309-61317331 AATCCCAATCCCTGCCTCGCTGG + Intergenic
1129070045 15:72943279-72943301 GCTCTCAGTCCATTCTTCCCAGG + Intergenic
1129368001 15:75068789-75068811 CCACCCAGTCCCTGCCTCACTGG - Intronic
1129450301 15:75647762-75647784 GCTGGCCGTCCCTGCCCCGCCGG + Intronic
1130397155 15:83512681-83512703 CCTCCCCGTCCCTGCCTCCCTGG + Intronic
1130828440 15:87573618-87573640 GGTGTCAGTCCCTCCCTCCCAGG + Intergenic
1131837984 15:96409417-96409439 GCTCCCCGGCCCTGCCCCGCCGG - Intergenic
1132349890 15:101133132-101133154 GCTCTCAGACCCTGCTCCCCGGG - Intergenic
1132420018 15:101657426-101657448 GCTCCCAGACCCTGACTCGTAGG + Intronic
1132779768 16:1616410-1616432 GCTCTCATTCCTTGCCTCACAGG - Intronic
1132951510 16:2564971-2564993 GCTCTCCGACCCTGCTCCGCCGG + Intronic
1132962840 16:2635199-2635221 GCTCTCCGACCCTGCTCCGCCGG - Intergenic
1132986004 16:2768007-2768029 GCTCTCTGTCCCTGCCCCTGGGG + Exonic
1132993294 16:2808536-2808558 GCTCCCAGTGCCTGCCTGCCTGG + Intergenic
1134681236 16:16127280-16127302 GATCTCATTCGCTGCCTCCCAGG + Intronic
1135128444 16:19831219-19831241 GCTCTCAGACCCAGCTTCTCAGG + Intronic
1136128716 16:28204821-28204843 GCTCTCAGTCCCTATCTTACTGG - Intronic
1136383050 16:29905839-29905861 GCGCTCAGCCCCTGCCACGTTGG - Exonic
1136866936 16:33766662-33766684 TCACTCAGGCCCTGCCTCCCTGG + Intergenic
1138105662 16:54286056-54286078 CCTCTCCGTCCGTGCCCCGCGGG - Exonic
1139573616 16:67828105-67828127 GGAATCAGTCCCTGCCTGGCTGG + Intronic
1139651156 16:68362645-68362667 GTTTGCAGGCCCTGCCTCGCCGG - Intronic
1141476895 16:84280061-84280083 GCTCCCAGCCGCTGCCTGGCCGG - Intergenic
1141763244 16:86042922-86042944 GCAGGCAGTCCCTGCCTCCCAGG + Intergenic
1203105226 16_KI270728v1_random:1349540-1349562 TCACTCAGGCCCTGCCTCCCTGG - Intergenic
1203128288 16_KI270728v1_random:1612828-1612850 TCACTCAGGCCCTGCCTCCCTGG + Intergenic
1143048797 17:4104987-4105009 GCTTTCATTCCCTGGCTCTCTGG - Intronic
1143110016 17:4547926-4547948 GCTCACAGCCCCTCCCTCCCAGG + Intronic
1144585826 17:16487106-16487128 GCTCTTAGTTCCTGCCACACTGG - Intronic
1144825464 17:18103316-18103338 GAACCCAGTCCCTACCTCGCAGG - Intronic
1149560416 17:57604440-57604462 ACTCTCCATCCCTGCCCCGCAGG - Intronic
1149621413 17:58048038-58048060 GCTCTCAGTCCCTGGCACACTGG - Intergenic
1151626832 17:75281854-75281876 GCTCTATGTCCCTGCCTCAAAGG - Intronic
1152341494 17:79728343-79728365 TCACTCAGGCCCTGCCTCCCTGG + Intergenic
1152688393 17:81706320-81706342 GATCTCAGCCCCCGCCTCCCGGG + Intronic
1153382280 18:4454104-4454126 GCGCGCTGTCCCGGCCTCGCTGG - Intronic
1153751892 18:8240749-8240771 TCTCTCCCTCCCTCCCTCGCGGG - Intronic
1157264230 18:46203661-46203683 GATCTCAGCCTCTGCCTCCCAGG + Intronic
1157309844 18:46544290-46544312 GGTCTTAGTCCCTTCCTCGTAGG + Intronic
1158351480 18:56568635-56568657 GCTCTCTGTCCCCGCCCCCCCGG - Intergenic
1158877249 18:61745149-61745171 GCTCTCACTCCCTGCATCAGTGG + Intergenic
1159608154 18:70496451-70496473 GCTCTCAGCCCCTGCCTGTGTGG + Intergenic
1161216562 19:3097581-3097603 GCTCTCATCCACTGCCTCCCTGG + Intronic
1161644926 19:5447278-5447300 GCACCCAGTCCCTGCCTGCCTGG - Intergenic
1162059876 19:8087969-8087991 GCCCTCAGTCCCTACCCAGCTGG - Intronic
1162560587 19:11416153-11416175 GCTCTGAGACCCTGCCTCTCTGG - Intronic
1163561427 19:18021632-18021654 GCCATCAGTGCCTGCCACGCTGG + Intergenic
1163634260 19:18431091-18431113 GCACTCGGGCCCTCCCTCGCTGG - Intronic
1165007485 19:32818644-32818666 GCTCCCAGGCCCTGCCACGAGGG - Intronic
1165010313 19:32841323-32841345 CCTCTCACTCCCTGCATGGCTGG - Intronic
1165101941 19:33444257-33444279 GCTTTCTGTCCCAGCCTGGCTGG - Intronic
1165511878 19:36270837-36270859 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165512430 19:36273338-36273360 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165512977 19:36275879-36275901 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165513533 19:36278434-36278456 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165514083 19:36280968-36280990 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165514635 19:36283505-36283527 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165515187 19:36286038-36286060 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165515737 19:36288574-36288596 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165516288 19:36291111-36291133 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165516840 19:36293637-36293659 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165517393 19:36296160-36296182 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165517945 19:36298695-36298717 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165518496 19:36301230-36301252 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165519045 19:36303762-36303784 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165519595 19:36306277-36306299 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165520145 19:36308805-36308827 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
1165623923 19:37269776-37269798 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165624469 19:37272317-37272339 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165625013 19:37274844-37274866 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165625550 19:37277382-37277404 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165626086 19:37279907-37279929 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165627167 19:37284955-37284977 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165627711 19:37287483-37287505 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165628246 19:37290007-37290029 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165628786 19:37292532-37292554 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165629328 19:37295058-37295080 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165629869 19:37297583-37297605 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165630413 19:37300111-37300133 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1165630950 19:37302649-37302671 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1166288182 19:41845228-41845250 TCTCCCCTTCCCTGCCTCGCGGG + Intronic
1167386484 19:49166921-49166943 GGTCTCCGTCCCTGTCTCTCCGG + Intronic
925187241 2:1857045-1857067 ACTCCCAGGCCCTGCCTCCCAGG - Intronic
925206901 2:2014723-2014745 GCACTCATTGCCTGCCTTGCTGG - Intronic
925866741 2:8234739-8234761 GCTCTCAAGCCCTGTCTTGCAGG - Intergenic
933457235 2:82531063-82531085 GCTCTTAGTCCCCGCATCGCGGG + Intergenic
937986486 2:127640421-127640443 TCTCCCAGGCCCTGCCTCCCAGG + Intronic
938931191 2:136088194-136088216 GGTCCCAAGCCCTGCCTCGCTGG + Intergenic
941309810 2:163913846-163913868 GCTCCCAAGCCCTGCCCCGCGGG - Intergenic
943842906 2:192602844-192602866 GCTCTTACTCCCCGCATCGCGGG - Intergenic
946487690 2:220116682-220116704 GCTCTCACTCCCTTCCTCAGAGG - Intergenic
948547869 2:238745553-238745575 GCTCCGAGTCCCTCCCTCCCAGG - Intergenic
948958960 2:241316548-241316570 GCTGCCTGTCCGTGCCTCGCTGG - Intronic
1170261023 20:14408593-14408615 GATCTCAGTCCCTGCTTCAGAGG + Intronic
1171382054 20:24741765-24741787 TCTCTCAGGCTCTGCCTCCCTGG - Intergenic
1171467243 20:25338377-25338399 GCTGTCAGCACCTGCCTCTCAGG + Intronic
1172791219 20:37506762-37506784 GCTCTCGGTCCCTGTCTAGCTGG + Intronic
1175125020 20:56744998-56745020 GCTCTTAGTCTCTGTCTCCCAGG + Intergenic
1176056269 20:63150832-63150854 GCTCTGAGACCCAGCCTGGCTGG - Intergenic
1176310054 21:5144771-5144793 GCCCGCAGTCCCCGCCTAGCAGG + Intronic
1176705990 21:10120266-10120288 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1179091444 21:38269745-38269767 GCTCTCTGTCCCCTCCTCTCTGG - Intronic
1179409955 21:41154735-41154757 CCTCTGAGTCCCTCCTTCGCAGG - Intergenic
1179847002 21:44117261-44117283 GCCCGCAGTCCCCGCCTAGCAGG - Intronic
1180613939 22:17115459-17115481 ACTCTCAGACCTTGCCTCCCGGG + Exonic
1181234950 22:21443131-21443153 GCTCTTTGTCCCTGCCTGGTGGG + Intronic
1182295021 22:29307324-29307346 GCTCTGAGTCCTGGCCCCGCAGG + Intronic
1182338107 22:29598580-29598602 CCTCTCAGTCCCAGCTACGCGGG + Intergenic
1183116616 22:35697345-35697367 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1183903528 22:41022831-41022853 GCACTCGGTGCCTGCCCCGCTGG + Intergenic
1184394366 22:44224206-44224228 CCTGTCTGTCCCTGCCTCTCGGG + Intergenic
1184814745 22:46861031-46861053 GCTCACTGTCTCTGCCTCCCGGG + Intronic
1185336083 22:50271495-50271517 GGTCTCAGTCCCAGCCGCTCCGG + Intergenic
1185388548 22:50547358-50547380 GCTGTCAGCCCCGGCCTCGCCGG - Intergenic
949883110 3:8676800-8676822 GCTCTCAGTCCCCGCCTCACTGG - Intronic
949883138 3:8676879-8676901 GCTCTCTGTCCCCGCCTCACGGG - Intronic
949883168 3:8676960-8676982 GCTCTCAGTCCCCGCCTCACAGG - Intronic
949883195 3:8677040-8677062 GCTCGCAGTCCCCGCCTCCTGGG - Intronic
949883220 3:8677120-8677142 GCTCTCAGTCCCTGCCTCGCGGG - Intronic
949883470 3:8678504-8678526 GCTCTCAGTCCCCGCCTCGCGGG - Intronic
949883495 3:8678583-8678605 GCTCTCAGTCCCTGCCTCGCGGG - Intronic
949883526 3:8678662-8678684 GCTCTCAATCCCCGCCTCGCGGG - Intronic
949883578 3:8678824-8678846 GTTCTCAGTCCCCGCCTCGTGGG - Intronic
949883605 3:8678906-8678928 GCTCTCAGTCCCCGCCTGGCGGG - Intronic
949883629 3:8678986-8679008 GCTCTCAGTCCCCACCTCGCGGG - Intronic
949883655 3:8679065-8679087 GCTCTCAGTCCCCGCCTCGCGGG - Intronic
949883680 3:8679142-8679164 CCTCTCAGTCCCCGCCTCGCGGG - Intronic
949883734 3:8679299-8679321 GCTCTTAGTCCCCGCCTCATGGG - Intronic
949883761 3:8679380-8679402 GCTCTCAGTCCCCTCCTCCTGGG - Intronic
949883794 3:8679460-8679482 GTTCTCAGTCCCCGCCTCCCGGG - Intronic
949883849 3:8679619-8679641 GCTCTCATTCCCCGCCTCACCGG - Intronic
949884118 3:8681098-8681120 GCTCTCAGAACCCGCCTCGCGGG - Intronic
949884172 3:8681255-8681277 GCTGTCAGTCCCTGCCTCACGGG - Intronic
949884199 3:8681334-8681356 GCTCTCAGTCCCCGAGCCGCGGG - Intronic
949884223 3:8681413-8681435 GCTCTCAGTCCCGGGCTCGCCGG - Intronic
949884252 3:8681491-8681513 GCTCTCAGTCCCCGCCTCGTGGG - Intronic
949884281 3:8681568-8681590 GCTCTCAGTCCCCGCTTCGTTGG - Intronic
949884336 3:8681725-8681747 GCTCTCACTCCCCGCCTCCCAGG - Intronic
950670910 3:14524917-14524939 CCTCTCAGTCACTGCCTCCCTGG - Intronic
950867918 3:16204179-16204201 GTTCCCTGTCCCTGCCTAGCAGG + Intronic
954135095 3:48578775-48578797 GGTCTCAGTCCCTGGCACACAGG - Intronic
954156655 3:48688788-48688810 GCCCTCAGCCCCTGACTTGCTGG - Intronic
954198151 3:49008141-49008163 GGTCTCAGCCCCTGCTTCCCCGG - Intronic
956316241 3:67940810-67940832 ACTTTCAGTTCCTGCCTGGCAGG - Intergenic
957077296 3:75612074-75612096 GCTTTCACTCCCTGCATCGCGGG + Intergenic
957077327 3:75612157-75612179 GCTCTCACTCCCCGCATCGCGGG + Intergenic
961274464 3:125715997-125716019 GCTCTGACTCCCTGCATAGCGGG - Intergenic
961277402 3:125738630-125738652 GCTCTTACTCCCCGCATCGCGGG - Intergenic
961877024 3:130031038-130031060 GCTCTTACTCCCCGCATCGCGGG + Intergenic
963055260 3:141181495-141181517 GCTCTCAGTCCCTACTTCCCTGG + Intergenic
963397906 3:144757113-144757135 GGTCCCAATCCCTGCCCCGCGGG - Intergenic
966600563 3:181770892-181770914 GCTCACAACCCCTGCCTCCCAGG - Intergenic
968464111 4:741935-741957 GCTGTCAGCCCCTGTCTTGCAGG + Intronic
968973669 4:3810179-3810201 GCACTCAGTGCCTGCCCCCCAGG + Intergenic
968989302 4:3898228-3898250 GCTCTTACTCCCCGCATCGCGGG + Intergenic
969022638 4:4148087-4148109 GCTCTTATTCCCCGCATCGCGGG + Intergenic
969025866 4:4171806-4171828 GCTCTTACTCCTTGCATCGCGGG + Intergenic
969662510 4:8538468-8538490 GCTCTCAGTACCTTCTTCGTTGG - Intergenic
969730879 4:8956919-8956941 GCTCTTACTCCCCGCATCGCGGG - Intergenic
969730911 4:8957000-8957022 GCTCTTACTCCCCGCATCGCGGG - Intergenic
969785033 4:9450828-9450850 GCTCTTACTCCCCGCATCGCGGG - Intergenic
969790499 4:9491105-9491127 GCTCTTACTCCCCGCATCGCGGG - Intergenic
969790526 4:9491188-9491210 GCTCTTACTCCCCGCATCGCGGG - Intergenic
969790841 4:9493341-9493363 GCTCTTACTCCCCGCATCGCGGG - Intergenic
969792744 4:9503262-9503284 GCTCTTACTCCCCGCATCGCGGG - Intergenic
969826009 4:9758883-9758905 GCTCTTACTCCCCGCGTCGCGGG - Intergenic
969852153 4:9966578-9966600 GCTCTCAACCCCCGCCTCCCAGG - Intronic
970159436 4:13174232-13174254 ACACTCAGTCCCTGCCTCTTCGG + Intergenic
978385534 4:108172721-108172743 GCCCTGCGTCCCTGCCTCGCTGG + Intergenic
980354398 4:131724276-131724298 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980355476 4:131729259-131729281 GCGCGCAGGCCCTGTCTCGCAGG + Intergenic
980356021 4:131731760-131731782 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980356554 4:131734248-131734270 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980357092 4:131736736-131736758 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980357633 4:131739231-131739253 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980358173 4:131741717-131741739 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980358704 4:131744211-131744233 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980359245 4:131746684-131746706 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980360327 4:131751647-131751669 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980360867 4:131754119-131754141 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980361410 4:131756602-131756624 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980361950 4:131759074-131759096 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980362493 4:131761557-131761579 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980363037 4:131764040-131764062 GCGCACAGGCCCTGTCTCGCAGG + Intergenic
980378252 4:131976952-131976974 GCGCACAGGCCCTGCCTCGCAGG - Intergenic
981044757 4:140254410-140254432 GCGCTCAGTCCCTGCATCCCAGG - Intergenic
986130060 5:4921646-4921668 GATCTCAGTTGCTGCCTAGCTGG + Intergenic
986314521 5:6577649-6577671 GCTCTCAGCCCCTGCCCCATGGG + Intergenic
987957922 5:24764064-24764086 GCTCTCAATCAGTTCCTCGCTGG + Intergenic
988993500 5:36693204-36693226 GCTCTCCGTCCCCGCTTGGCAGG - Intergenic
990700243 5:58467151-58467173 ACTCTCAGTCTCTGCCTGGGAGG + Intergenic
990905121 5:60795219-60795241 TCTCTCAGTACCTTCCTCTCGGG - Intronic
991926489 5:71710244-71710266 GCCCCCAGGCCCTGCCTCTCTGG + Intergenic
1002091595 5:176809902-176809924 ACCCGCAGTCCCAGCCTCGCAGG - Intergenic
1002133423 5:177094741-177094763 TTTCTCAATCCCTGCCTCCCAGG - Intronic
1002495739 5:179610341-179610363 GCTTCCAGTCCCTCCCTCGGAGG + Intergenic
1002640139 5:180626833-180626855 GCTCTCACTGCCTGCCTCGCTGG + Intronic
1003191928 6:3881878-3881900 GCTCACAGTCCCAGCCTAGTAGG - Intergenic
1006199138 6:32270723-32270745 GCTCTCACTCCCCGCATCGCGGG - Intergenic
1006313507 6:33277539-33277561 GCTCCCAGCCCCCGCCTCACCGG + Exonic
1006516736 6:34549650-34549672 GCTCTCAGGCCCTACCTCCTGGG + Intronic
1007630262 6:43269542-43269564 GCTCACAGCCCCTGCGGCGCCGG - Intronic
1015815367 6:137205349-137205371 GCTCTCAGACCCTGACTCCTGGG - Intronic
1018793983 6:167171951-167171973 CCTCTCAGTCCCTCCCTCTGTGG + Intronic
1018822352 6:167383126-167383148 CCTCTCAGTCCCTCCCTCTGTGG - Intronic
1019302969 7:318195-318217 GTTCTCAGGACCTGCCTGGCTGG - Intergenic
1021166394 7:17347788-17347810 GCTAACAGTACCTGCCTCACTGG + Intergenic
1023147927 7:37170680-37170702 GCTCACTGTCTCTGCCTCCCAGG + Intronic
1023337556 7:39186263-39186285 GCTCTCAGTCCTTGCCCCGCAGG - Intronic
1024228227 7:47344699-47344721 GCACTCAGGCGCTGCATCGCGGG - Intronic
1024513455 7:50221275-50221297 GCTCCCAGCCCCTCCCTCTCTGG + Intergenic
1025202438 7:56970589-56970611 GGTCCAAGCCCCTGCCTCGCTGG + Intergenic
1025669510 7:63606338-63606360 GGTCCAAGCCCCTGCCTCGCTGG - Intergenic
1026252661 7:68684447-68684469 GCTCTCAGCACCTGCCTAGCCGG + Intergenic
1031468610 7:122143942-122143964 GCTCTCCCTCCATTCCTCGCAGG + Intronic
1032083870 7:128873521-128873543 GCTCTCAGCCCCTGTGTCTCAGG + Intronic
1032746665 7:134793130-134793152 CCTCTCAGCGCCTGCCTCCCTGG - Intronic
1033551759 7:142453731-142453753 CCTCTCAGTCCCGGCCTCTCTGG + Intergenic
1034303148 7:150033574-150033596 GCTCTCAGTCCCCGCCTCGCAGG + Intergenic
1034303174 7:150033654-150033676 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034303227 7:150033815-150033837 GCTCTCAGTCCCTGCCTCGTGGG + Intergenic
1034303282 7:150033972-150033994 GTTCGCAGTCCCCGCCTCGGGGG + Intergenic
1034303310 7:150034051-150034073 GCTCTGAGTCCCCGCCTCGCGGG + Intergenic
1034303459 7:150034794-150034816 GCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1034303486 7:150034874-150034896 GCTCTCAGTCCCTACCTCGCGGG + Intergenic
1034303574 7:150035182-150035204 GCTCTCAGTCCCCGCCTCACGGG + Intergenic
1034303656 7:150035425-150035447 GCTCTCAGTCCCTGACTCGCGGG + Intergenic
1034303736 7:150035730-150035752 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1034303763 7:150035811-150035833 GCTCTCAGTCCCTGCCTTGCGGG + Intergenic
1034303817 7:150035973-150035995 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034303869 7:150036131-150036153 GCTCTGAGTCCCCGCCTCGTGGG + Intergenic
1034304023 7:150036882-150036904 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1034304051 7:150036963-150036985 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034304109 7:150037125-150037147 GCTCTCAGTCCCTGCCTCGTGGG + Intergenic
1034304168 7:150037351-150037373 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1034304195 7:150037432-150037454 GCTCTCAATCCCTGCCTCGCGGG + Intergenic
1034304367 7:150037978-150038000 GTTCGCAGTCCCCGCCTCGCGGG + Intergenic
1034304394 7:150038057-150038079 GCTCTGAGTCCCCACCTCGCGGG + Intergenic
1034304540 7:150038779-150038801 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1034304570 7:150038860-150038882 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034304654 7:150039169-150039191 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1034304684 7:150039250-150039272 GCTCTCAATCTCTGCCTCGGGGG + Intergenic
1034304739 7:150039410-150039432 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034304862 7:150039796-150039818 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034304912 7:150039954-150039976 GTTCGCAGTCCCCGCCTCGCGGG + Intergenic
1034304936 7:150040033-150040055 GCTCTGAGTCCCCGCCTCGCGGG + Intergenic
1034305085 7:150040779-150040801 GCTCTCAGTCCCCGCCTTGCGGG + Intergenic
1034305230 7:150041526-150041548 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1034305260 7:150041607-150041629 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034305320 7:150041770-150041792 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034305405 7:150042077-150042099 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034305434 7:150042158-150042180 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034305493 7:150042320-150042342 GCTCTCAGTCCCTGCCTCGCGGG + Intergenic
1034305543 7:150042478-150042500 GTTCGCAGTCCCCGCCTCGCGGG + Intergenic
1034305569 7:150042557-150042579 GCTCTGAGTCCCCGCCTCGCGGG + Intergenic
1034305717 7:150043303-150043325 GCTCTCAGTCCCCGCCTTGCGGG + Intergenic
1034801126 7:154057347-154057369 GCTCTCAGTCCCCGCCTCGCGGG - Intronic
1034801275 7:154058095-154058117 GCTCTGAGTCCCCGCCTCATGGG - Intronic
1034801305 7:154058175-154058197 GTTCGCAGTCCCCGCCTCGCGGG - Intronic
1034801358 7:154058333-154058355 GCTCTCAGTCCCTGCCTCGCGGG - Intronic
1034801440 7:154058575-154058597 GCTCTCAGTCCCCGCCTCGCGGG - Intronic
1034801552 7:154058963-154058985 GCTCTCAGTCCCTGCCTCGCGGG - Intronic
1034801580 7:154059043-154059065 GCTCTCAGTCCCCGCCTCGTGGG - Intronic
1034801633 7:154059205-154059227 GCTCTCAGTCCCTACCTCGCGGG - Intronic
1034801660 7:154059285-154059307 GCTCTCAGTCCCCGCCTCAAGGG - Intronic
1034801810 7:154060027-154060049 GCTCTGAGTCCCCGCCTCGCGGG - Intronic
1034801889 7:154060263-154060285 CCTCTCAGTCCCTGCCTCGCGGG - Intronic
1034801918 7:154060343-154060365 GCTCTCAGTCCCTGCCTCGCGGG - Intronic
1034801948 7:154060424-154060446 GCTCGCAGTCCCCGCCTCGCGGG - Intronic
1034802032 7:154060731-154060753 GCTCTCAGTCCCTGCCTCGCGGG - Intronic
1034802058 7:154060811-154060833 GCTCTCAGTCCCTGCCTCATGGG - Intronic
1034802083 7:154060891-154060913 GCTCTCAGTCCCCGCCTCGTGGG - Intronic
1034802259 7:154061713-154061735 GTTCGCAGTCCCCGCCTCGCGGG - Intronic
1034802310 7:154061871-154061893 CCTCTCAGTCCCTGCCTCGCGGG - Intronic
1034802368 7:154062032-154062054 GCTGTCAGTCCCTGCCTCGCGGG - Intronic
1034802397 7:154062113-154062135 GCTCTCAGTCCCCGCCTCGCGGG - Intronic
1034802627 7:154062825-154062847 GCTCGCAGTCCCCGCCTCGCGGG - Intronic
1034802739 7:154063214-154063236 GCTCTCAGTCCCTGCCTCGCGGG - Intronic
1034802769 7:154063294-154063316 GCTCTCAGTCCCCGCCTCATGGG - Intronic
1034802819 7:154063455-154063477 GCTCTCAGTCCCTGCCTCGCGGG - Intronic
1034802870 7:154063615-154063637 GCTCTCAGTCCCTGCCTCGTGGG - Intronic
1034802898 7:154063695-154063717 GCTCTCAGTCCCCACCTCACGGG - Intronic
1034879377 7:154751754-154751776 CCTATCCGTCCCTGCCTCGGGGG - Intronic
1035061887 7:156075399-156075421 GCTCTTGGTACCTGCCTGGCTGG + Intergenic
1035742580 8:1939400-1939422 GCTCTCAGTCCCAGGATGGCTGG + Intronic
1036833958 8:12043087-12043109 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1036855804 8:12289652-12289674 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1036904134 8:12693498-12693520 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1039439468 8:37584709-37584731 ACTCTCCGGCCCTGCCTCCCTGG + Intergenic
1041389020 8:57332631-57332653 CCTCTCAGCCCCTGCATGGCCGG + Intergenic
1041478407 8:58291736-58291758 TCTCTCAGTCCCTGACCAGCTGG + Intergenic
1042824145 8:72963283-72963305 GCTCTCACACCTTGCCTGGCAGG + Intergenic
1045392495 8:101729494-101729516 GCTCACATGCCCAGCCTCGCTGG - Intronic
1046161703 8:110375384-110375406 GCTCTCAGTACCTGGGTGGCAGG - Intergenic
1046521368 8:115330695-115330717 GGTCCCAAGCCCTGCCTCGCAGG + Intergenic
1047922908 8:129653875-129653897 GCCCCCAGTCCCTGCCTCTTTGG - Intergenic
1049082100 8:140451443-140451465 GGTCACAGTCACTGCCTCCCAGG - Intronic
1053169998 9:35871763-35871785 CCTCTCAGTGCCTTCCTTGCAGG + Intergenic
1053736146 9:41104223-41104245 GCTGTCAGTCCCCTCCTCGCGGG - Intergenic
1053736204 9:41104604-41104626 GCTCTCAGTCACCGCCTCGCGGG - Intergenic
1053736231 9:41104684-41104706 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053736257 9:41104764-41104786 GCTCTGAGACCCCGCCTCGCGGG - Intergenic
1053736284 9:41104843-41104865 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053736574 9:41106694-41106716 TCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053736645 9:41106933-41106955 ACTCTGAGTCCTTGCCTCGCGGG - Intergenic
1053736692 9:41107090-41107112 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053736731 9:41107195-41107217 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053736760 9:41107271-41107293 GCTGTCAGTCCCCGCCACGCGGG - Intergenic
1053736786 9:41107350-41107372 GCTCTCAGTCCCCGCCTCACGGG - Intergenic
1053736812 9:41107430-41107452 GCTCTTAGACACCGCCTCGCGGG - Intergenic
1053736837 9:41107508-41107530 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053736982 9:41108257-41108279 GCTCTCTGTCCCCGCCTCGCCGG - Intergenic
1053737006 9:41108337-41108359 GCTCTCAGTCCCTGCCTCGCGGG - Intergenic
1053737058 9:41108497-41108519 GTTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053737086 9:41108577-41108599 GCTCTCAGTCCACGCCTCGTGGG - Intergenic
1053737116 9:41108656-41108678 GCTCTCAGTCCCCTCCTCCCGGG - Intergenic
1053737146 9:41108736-41108758 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053737174 9:41108816-41108838 GCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1053737205 9:41108898-41108920 GCTCGCAGTCCCTGTCTCGCGGG - Intergenic
1053737232 9:41108977-41108999 CCTCTCAGTCCCCGCCTCGCGGG - Intergenic
1054691117 9:68322342-68322364 CCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054691144 9:68322421-68322443 GCTCGCAGTCCCTGTCTCGCGGG + Intergenic
1054691174 9:68322501-68322523 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054691202 9:68322581-68322603 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054691232 9:68322661-68322683 GCTCTCAGTCCCCTCCTCCCGGG + Intergenic
1054691262 9:68322740-68322762 GCTCTCAGTCCACGCCTCGTGGG + Intergenic
1054691290 9:68322820-68322842 GTTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054691368 9:68323060-68323082 GCTGTCAGTCCCTGCCTCGCGGG + Intergenic
1054691392 9:68323140-68323162 GCTCTCTGTCCCCGCCTCGCCGG + Intergenic
1054691536 9:68323889-68323911 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054691561 9:68323967-68323989 GCTCTTAGACACCGCCTCGCGGG + Intergenic
1054691587 9:68324047-68324069 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054691613 9:68324126-68324148 GCTGTCAGTCCCCGCCACGCGGG + Intergenic
1054691642 9:68324205-68324227 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054691679 9:68324310-68324332 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054691727 9:68324468-68324490 ACTCTGAGTCCTTGCCTCGCGGG + Intergenic
1054691797 9:68324706-68324728 TCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054692089 9:68326557-68326579 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054692116 9:68326636-68326658 GCTCTGAGACCCCGCCTCGCGGG + Intergenic
1054692143 9:68326716-68326738 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1054692170 9:68326796-68326818 GCTCTCAGTCACCGCCTCGCGGG + Intergenic
1054692228 9:68327177-68327199 GCTGTCAGTCCCCTCCTCGCGGG + Intergenic
1056864798 9:90219886-90219908 GCTCTCAGTCCCCGCATCGCGGG - Intergenic
1056918229 9:90763000-90763022 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1056918257 9:90763079-90763101 GCTCTTACTCCCCGCATCGCGGG + Intergenic
1058456975 9:105146933-105146955 ACTCTCAGTCCCAGCATCACAGG + Intergenic
1058639597 9:107069913-107069935 GATTTCAGTCCCTGCCTCCAAGG + Intergenic
1058646790 9:107138516-107138538 GCTCCCAGCACCTGCCTCTCTGG + Intergenic
1059767052 9:117393690-117393712 GCTCTCAGTCCCTGCGAGACAGG - Intronic
1060141053 9:121210514-121210536 GCTCTCAGTGGCTGTCTCTCTGG - Intronic
1060161557 9:121369775-121369797 GGTCCCGGTCCCCGCCTCGCTGG + Intronic
1060599764 9:124869781-124869803 GCACTCCGTCCCTCCCTTGCAGG + Intronic
1061040429 9:128138439-128138461 GCTCTCAGTCCCCGCCTCTCGGG + Intergenic
1061040458 9:128138519-128138541 GCTCTCAGTCCCCGCCTAGCGGG + Intergenic
1061040485 9:128138599-128138621 GCTCTCAGGCACCGCCTCGCGGG + Intergenic
1061040513 9:128138677-128138699 GCTCTCAGTCTCCGCCTCGCGGG + Intergenic
1061040541 9:128138757-128138779 GCTGTCAGTCCCCGCCTCGCGGG + Intergenic
1061040567 9:128138836-128138858 CCTCTCAGTCCCCGCCTCGTGGG + Intergenic
1061040598 9:128138917-128138939 GCTCTCAGTCCCCGCCTCGCGGG + Intergenic
1061040626 9:128138996-128139018 GCTCTCAGTCCCCGCCATGCTGG + Intergenic
1061040650 9:128139073-128139095 GCTCTCAGTCGCCGACTCCCGGG + Intergenic
1061040704 9:128139234-128139256 GCTCTGAGTCCCCGCCTCGCGGG + Intergenic
1061040760 9:128139393-128139415 GCTGTCAGTTCCCGCCTAGCGGG + Intergenic
1061040809 9:128139553-128139575 GCTCTCAGTCCCCGCCTCACGGG + Intergenic
1061040837 9:128139635-128139657 GCTGTCAGTCCCCGCCTCGCGGG + Intergenic
1061040865 9:128139715-128139737 GCTCCCAGTCCCCAACTCGCGGG + Intergenic
1061436905 9:130569470-130569492 GCTCGCAGCCTCTGCCTCCCTGG - Intergenic
1061913990 9:133739602-133739624 ATTCTCAGTCCCTGCCTCAAAGG + Intronic
1062509278 9:136895973-136895995 CCTGTCAGTCCCTGCCTCCCTGG + Intronic
1202791024 9_KI270719v1_random:90355-90377 GCGCACAGGCCCTGTCTCGCAGG - Intergenic
1187443822 X:19343784-19343806 GCCCTCAGCCCCTCCCTCTCTGG + Intergenic
1189371828 X:40434888-40434910 CCCCTGAGTCACTGCCTCGCAGG + Intergenic
1190333195 X:49248183-49248205 GCACTCAGACTCTGCCTGGCCGG - Exonic
1195626059 X:107006583-107006605 GCTCTCAGAGCCTGCTTCCCTGG - Intergenic
1200117997 X:153777506-153777528 GCCCTTATCCCCTGCCTCGCAGG + Exonic