ID: 1109538079

View in Genome Browser
Species Human (GRCh38)
Location 13:63741448-63741470
Sequence CTCTCAGTCCCTGCCTCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 30, 1: 79, 2: 120, 3: 98, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109538071_1109538079 6 Left 1109538071 13:63741419-63741441 CCTAAGAGCCAGTGGGGAAGAGG No data
Right 1109538079 13:63741448-63741470 CTCTCAGTCCCTGCCTCGCGGGG 0: 30
1: 79
2: 120
3: 98
4: 203
1109538065_1109538079 26 Left 1109538065 13:63741399-63741421 CCCCTCACTGAGATGGGGGTCCT No data
Right 1109538079 13:63741448-63741470 CTCTCAGTCCCTGCCTCGCGGGG 0: 30
1: 79
2: 120
3: 98
4: 203
1109538076_1109538079 -2 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538079 13:63741448-63741470 CTCTCAGTCCCTGCCTCGCGGGG 0: 30
1: 79
2: 120
3: 98
4: 203
1109538066_1109538079 25 Left 1109538066 13:63741400-63741422 CCCTCACTGAGATGGGGGTCCTA No data
Right 1109538079 13:63741448-63741470 CTCTCAGTCCCTGCCTCGCGGGG 0: 30
1: 79
2: 120
3: 98
4: 203
1109538067_1109538079 24 Left 1109538067 13:63741401-63741423 CCTCACTGAGATGGGGGTCCTAA No data
Right 1109538079 13:63741448-63741470 CTCTCAGTCCCTGCCTCGCGGGG 0: 30
1: 79
2: 120
3: 98
4: 203
1109538064_1109538079 29 Left 1109538064 13:63741396-63741418 CCTCCCCTCACTGAGATGGGGGT No data
Right 1109538079 13:63741448-63741470 CTCTCAGTCCCTGCCTCGCGGGG 0: 30
1: 79
2: 120
3: 98
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109538079 Original CRISPR CTCTCAGTCCCTGCCTCGCG GGG Intergenic
900889022 1:5435845-5435867 CTCACAGTCCTTGCCTGGAGGGG + Intergenic
900959436 1:5909776-5909798 TTCTCAGTCCCTGGCTCCAGGGG - Intronic
901004773 1:6166399-6166421 CTCCCAGCCCCTGCCTTGTGGGG - Intronic
901445610 1:9306151-9306173 CCCTCAGTCCCTGCCCTGTGGGG - Intronic
903404868 1:23087932-23087954 CTCACAGTCCATGCCTCTCATGG + Exonic
903741478 1:25560917-25560939 CTCCCAGTCCCTGCCCAGCCTGG + Intronic
904513220 1:31031861-31031883 CTCTCGCTCCCTGCCTCCCCTGG + Intronic
907385031 1:54120727-54120749 CTCGCAGTCCCTGCAACGCGGGG + Intergenic
907524824 1:55047986-55048008 TTCTCAGTCCCTGCCTGGACTGG - Intronic
907558508 1:55366831-55366853 CTCTCTCTCTCTGCCTCGTGAGG + Intergenic
912334697 1:108851320-108851342 CTCTGAGTTCCTGCCTTGCGTGG - Intronic
913229785 1:116732171-116732193 CTCTCAGGCCCTGCATGGCCTGG + Intergenic
917459567 1:175218368-175218390 CTCTCAGTCACTGCTTCCTGGGG - Intergenic
918095382 1:181329995-181330017 CTCCCAGTCCCTGACTCAGGAGG + Intergenic
919297066 1:195715832-195715854 CTCTGACTCCCTGCCTCCTGTGG - Intergenic
920193549 1:204211296-204211318 CTCACAGGCCCTGCCTGGTGGGG + Intronic
920273921 1:204789881-204789903 CTCCCAGTCCTTGCCTCTCCTGG + Intergenic
922350085 1:224728232-224728254 CTCACAGCCACTGCCTCCCGGGG + Intronic
923337050 1:232979631-232979653 TCCACAGTCCCTGCCTGGCGGGG + Exonic
1064777181 10:18792033-18792055 CTCACAGTCCCAGCCCCACGTGG + Intergenic
1065712504 10:28532266-28532288 CTTTCATTCCCTGCCCCGAGCGG + Intergenic
1071918458 10:90323199-90323221 CTCTCTGTCCCTGTCCCACGTGG + Intergenic
1072938354 10:99734355-99734377 CTATCAGTCCCTGTCCGGCGCGG - Intronic
1074003269 10:109393415-109393437 CTCTCACTCACTGCCTCCCTTGG - Intergenic
1076369968 10:129946178-129946200 CCCTCGGTCCTGGCCTCGCGCGG + Intronic
1076554261 10:131311746-131311768 CGCTCCGCCCCTGCCCCGCGCGG + Intergenic
1076683151 10:132185663-132185685 CGCTTAGTCCCGGCCACGCGTGG - Intergenic
1077576385 11:3387006-3387028 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1077576415 11:3387087-3387109 TTCTTACTCCCTGCATCGCGGGG + Intergenic
1077576508 11:3387474-3387496 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1078514245 11:12009025-12009047 CTCTCAGCCCCTACCTGGGGTGG + Exonic
1078618054 11:12883027-12883049 CCCTCAGTCCCTGCCTGGCAAGG + Exonic
1079079835 11:17406587-17406609 CTCACAGTCCCAGCCTGGCCAGG + Intronic
1084228381 11:67732024-67732046 CTATTAGTCCCCGCATCGCGGGG + Intergenic
1084228404 11:67732102-67732124 CTATTAGTCCCCGCATCGCGGGG + Intergenic
1084228425 11:67732180-67732202 CTATTAGTCCCAGCATCGCGGGG + Intergenic
1084264096 11:67996097-67996119 CTCTTACTCCCCGCATCGCGGGG + Intronic
1084304402 11:68272103-68272125 CTCTCAGGCCCCGCCTCCCCGGG + Intergenic
1084784530 11:71434541-71434563 GTCTCAGTCCCAGCCTCGGGAGG - Exonic
1084806753 11:71584548-71584570 CTCTTACTCCCCGCATCGCGGGG - Intronic
1084808961 11:71600714-71600736 CTCTTACTCCCCGCATCGCGGGG - Intronic
1084843970 11:71884954-71884976 CTCTTACTCCCTGCATCGTGGGG - Intronic
1084846808 11:71907355-71907377 CTCTTACTCCCCGCATCGCGGGG - Intronic
1085299548 11:75450212-75450234 CTCGCTGTCCCTTCCTCGCTGGG - Intronic
1087102598 11:94380090-94380112 CTCTCTTTCCCTGCCTCAGGTGG + Exonic
1090840805 11:130486488-130486510 CCCTCAGTCCCTGCTCCTCGTGG - Intergenic
1091732355 12:2890651-2890673 CGCTCAGTACCGGCCCCGCGAGG + Intronic
1092433028 12:8424170-8424192 CTCTTACTCCCCGCATCGCGTGG + Intergenic
1092433057 12:8424250-8424272 CTCTTACTCCCTGCATCGCGGGG + Intergenic
1092436273 12:8449205-8449227 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1092537360 12:9402803-9402825 CTCTCAGTCCCCGCCTCGCTTGG - Intergenic
1092537382 12:9402883-9402905 CTGTCAGTCCCCGTCTCCCGCGG - Intergenic
1092537455 12:9403120-9403142 CTGTCAGTCCCTGCCTCGCTGGG - Intergenic
1092537480 12:9403200-9403222 CTCTCAGTCCCCGCCTCGCGAGG - Intergenic
1092537507 12:9403280-9403302 CTCTCAGTCCCCGCCTCGCTGGG - Intergenic
1092537533 12:9403362-9403384 CTCTCAGTCCCCGCCTCACAGGG - Intergenic
1092537557 12:9403440-9403462 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1092537589 12:9403521-9403543 CTCTCAGTCCCCACCTCGCGGGG - Intergenic
1092537752 12:9403943-9403965 TTCTCAGTCCCCGCCTCGCATGG - Intergenic
1092537776 12:9404023-9404045 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1092537824 12:9404179-9404201 CTCTCAGTCCCCGCCTCATGTGG - Intergenic
1092537862 12:9404284-9404306 CTCTCCGTCCCTGCCTCGCGGGG - Intergenic
1092537885 12:9404362-9404384 CTCTCAGTACCCGCCTCGCGTGG - Intergenic
1092537907 12:9404443-9404465 CTCTCAGTCCCCGCCTTGCATGG - Intergenic
1092537931 12:9404520-9404542 CTCTCAATCCCCGCCTCGCATGG - Intergenic
1092537995 12:9404710-9404732 CTGTCAGTCCCCGCCTCGCTGGG - Intergenic
1092538018 12:9404790-9404812 CTCTCAGAACCTGGCTCGCGGGG - Intergenic
1092538040 12:9404869-9404891 CTCTCAGTCTCTGCCTCGCGGGG - Intergenic
1092538069 12:9404948-9404970 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1092538100 12:9405026-9405048 CTCTCAGTCCCCGCCCCGTGGGG - Intergenic
1092538125 12:9405105-9405127 CTCTCAGTCCCAGCCTCCTGGGG - Intergenic
1092538150 12:9405184-9405206 CTCTCAGTCCCAGCCTTGTAGGG - Intergenic
1092538411 12:9405823-9405845 CTCGCAGTCCCCGACTCGTGGGG - Intergenic
1092538444 12:9405902-9405924 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1092538476 12:9405984-9406006 CTCTCAGTCCCCGCCCCGTGGGG - Intergenic
1092538504 12:9406064-9406086 CTCTCAGTCCCGGCCTCCTGGGG - Intergenic
1092538528 12:9406143-9406165 CTCTCAGTCCCAGCCTCGTAGGG - Intergenic
1092538552 12:9406221-9406243 CTCTCAGTCCCCGCCTCGTGGGG - Intergenic
1092538618 12:9406508-9406530 CTCTCAGTCCCTGCCTCGCGGGG - Intergenic
1092538648 12:9406588-9406610 CTCTCAGTCCCCGCCTCGTGTGG - Intergenic
1092538673 12:9406668-9406690 CTCTCCGTCCCTGCCTCGCGGGG - Intergenic
1092538697 12:9406746-9406768 CTCTCAGTACCTGCCTCGCGTGG - Intergenic
1092538718 12:9406824-9406846 CTCTCAGTCCCTGCCTCACGGGG - Intergenic
1092538742 12:9406903-9406925 CTCTCAGTCCCCGCCTCGCATGG - Intergenic
1092538800 12:9407062-9407084 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1092538823 12:9407142-9407164 CTCTCAGTCTCTGCCTCGCGGGG - Intergenic
1092538850 12:9407222-9407244 CTCTCAGTCCGTGCCTCACGGGG - Intergenic
1092539101 12:9408634-9408656 CACTCAGTCCCCGCCTCGCGGGG - Intergenic
1092556577 12:9567697-9567719 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1092556608 12:9567777-9567799 CTCTCAGTCACTGCCTCGTGGGG + Intergenic
1092556634 12:9567856-9567878 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1092556912 12:9569345-9569367 CTCTCAGTCCCTGCCTCGCGAGG + Intergenic
1092556960 12:9569502-9569524 CTCTCAGTCCCCGCCTCGTGAGG + Intergenic
1092556988 12:9569582-9569604 CTCTCAGTCCGCGCCTCACGGGG + Intergenic
1092557014 12:9569662-9569684 CTCTCAGTCTCTGCCTCGCGGGG + Intergenic
1092557035 12:9569742-9569764 CGCTCAGTCCCCGCCTCGCATGG + Intergenic
1092557073 12:9569863-9569885 CTCTCAGTCCCCGCATCGCGTGG + Intergenic
1092557165 12:9570123-9570145 CTCTCAGTCCCCGCCCCGTGGGG + Intergenic
1092557193 12:9570203-9570225 CTCTCAGTCCCCACCTCGCGGGG + Intergenic
1092557290 12:9570413-9570435 CTTTCAGTCCCTGCCTCGCGGGG + Intergenic
1092557319 12:9570495-9570517 CTCTCAGTCCCCGCCTCGCTGGG + Intergenic
1093143829 12:15540913-15540935 CTCTCATTCCATGCCTCTCCGGG - Intronic
1094513925 12:31117334-31117356 CTCTCAGTCCCCGCCTCGCGTGG - Intergenic
1094513999 12:31117621-31117643 CTCTCAGTTCCCGCCTCACGAGG - Intergenic
1094514024 12:31117700-31117722 TTCTCAGTCCTCGCCTCGCGGGG - Intergenic
1094514075 12:31117859-31117881 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1094514150 12:31118095-31118117 CTCTCAGTCCCCGCTTCGCGGGG - Intergenic
1094514179 12:31118175-31118197 CTCTCAGTCCCCGCCTCGCAGGG - Intergenic
1094514204 12:31118254-31118276 CTCTCAGTCCCCGCCTCTCCGGG - Intergenic
1094514234 12:31118332-31118354 CTCTCAGTCCCCGCCTCGTGGGG - Intergenic
1094514261 12:31118411-31118433 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1094514280 12:31118490-31118512 CTCTCAGTCACCGCCTCGTGAGG - Intergenic
1094514335 12:31118648-31118670 CTCTCGATCCCCGCCTCTCGGGG - Intergenic
1094514501 12:31119255-31119277 CTCTCAGTCCCCGAATCGCGTGG - Intergenic
1094514552 12:31119413-31119435 CTCTCAATCCTCGCCTCGCCGGG - Intergenic
1094514578 12:31119493-31119515 CTCTCAGTCCCTGCCTCGCGGGG - Intergenic
1094514604 12:31119573-31119595 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1094514633 12:31119655-31119677 CTCTCAGTTCCTGCCTCGCAGGG - Intergenic
1094514660 12:31119733-31119755 CTCTCAGTCCCCGCCTCGTGTGG - Intergenic
1094514689 12:31119813-31119835 CTCTCCGTCCCTGCCTCTCGGGG - Intergenic
1094514711 12:31119891-31119913 CTCTCAGTACCCGCCTCGCGTGG - Intergenic
1094514729 12:31119968-31119990 CTGTCAGTCCCTGCCTGGCGGGG - Intergenic
1094514778 12:31120125-31120147 CTCTCCGTCCCCGCCTCGCGGGG - Intergenic
1094514832 12:31120285-31120307 CTCTCAGTCCCCGCATCGCGTGG - Intergenic
1094514869 12:31120377-31120399 CTGTCAGACCCCGCCTCGCATGG - Intergenic
1094514979 12:31120812-31120834 CTCTCAGTCCCCGCTTCGCGGGG - Intergenic
1094515009 12:31120894-31120916 CTCTCAGTCCCCGCCTCTCAGGG - Intergenic
1094515037 12:31120974-31120996 CTCTCACTCCCCGCCTCGCGGGG - Intergenic
1094515069 12:31121053-31121075 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1094515331 12:31122466-31122488 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1094515362 12:31122546-31122568 CTCTCAGTCCCCCCCTCGCGGGG - Intergenic
1094515397 12:31122625-31122647 CTCTCAGTCCCCGCCTCGAGGGG - Intergenic
1094515451 12:31122783-31122805 CTCTCAGTCCCTGCCTCGCGGGG - Intergenic
1094515480 12:31122862-31122884 CTCTCAATCCCCACCTCACGGGG - Intergenic
1094515510 12:31122941-31122963 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1096649152 12:53053422-53053444 CTGTCAGGCCTTGCCTCCCGTGG + Exonic
1097604911 12:61742016-61742038 CTTGCAGTCCCGGCCTCGGGAGG - Intronic
1099663512 12:85596705-85596727 CTGTCAGTCCCAGCCTCTCCAGG - Intergenic
1099793352 12:87363871-87363893 CTCTCACTCACTGCCTCCCTTGG + Intergenic
1103844418 12:123891612-123891634 CTCTCAGTCTCTTCCTCCCGGGG - Intronic
1104660979 12:130611286-130611308 CACTCAGTGCCTGCCTCTCCAGG + Intronic
1104892634 12:132147824-132147846 CCCCCAGTCCCTGCCTCCCTGGG - Intronic
1106115698 13:26815893-26815915 CTCTCAGCTCCTGCCTGTCGAGG + Intergenic
1107545159 13:41428005-41428027 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1107545188 13:41428087-41428109 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1107726621 13:43305947-43305969 CTCTCAGCCCCTGCCCAGCCTGG + Intronic
1107940211 13:45376522-45376544 CTCTCAGTCCCTACCTCGTGGGG + Intergenic
1107940372 13:45377281-45377303 CTCTCAGTCCCCGCCTTGCTGGG + Intergenic
1107940406 13:45377361-45377383 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1107940433 13:45377440-45377462 CTCTCAGTCCCTGCCTTGTTGGG + Intergenic
1107940462 13:45377518-45377540 CTCTCAGTACCTGCCTCATTGGG + Intergenic
1107940487 13:45377598-45377620 CTCTCAGTCCCCACCTCGTGGGG + Intergenic
1107940513 13:45377677-45377699 CTCTGCGTCCCTGCCTCGTGGGG + Intergenic
1107940539 13:45377757-45377779 CTCTCAGTCCCTGCCTCGTGGGG + Intergenic
1107940569 13:45377836-45377858 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1107940600 13:45377914-45377936 CTCTCAGTCCCTGCCTCGTTGGG + Intergenic
1107940630 13:45377993-45378015 CTCTCAGTCCGTGCCTGGCGGGG + Intergenic
1107941043 13:45380065-45380087 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1107941075 13:45380144-45380166 CTCTCAGTCCCTGCCTCGTTGGG + Intergenic
1107941101 13:45380222-45380244 CTCTCAGTCCCAGCCTCGTGGGG + Intergenic
1107941129 13:45380301-45380323 CTCTGAGTCCCTGCCTCGTGGGG + Intergenic
1107941159 13:45380380-45380402 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1107941189 13:45380457-45380479 CTCTCAGTCCCTGCCTCGTTGGG + Intergenic
1107941219 13:45380536-45380558 CTCTCAGTCCGTGCCTGGCGGGG + Intergenic
1107941381 13:45381281-45381303 CTCTCAGTCCCTGCCTCCCGGGG + Intergenic
1107941412 13:45381359-45381381 CTCTCAGTCCCTGCCTCGTTGGG + Intergenic
1107941433 13:45381438-45381460 CTCTCAATCCCTGCATCGTTAGG + Intergenic
1107941458 13:45381517-45381539 CTCTCAGTCCCCGCCTCGTAGGG + Intergenic
1107941489 13:45381596-45381618 CTCTGAGTCCCTGCCTCGTGGGG + Intergenic
1107941518 13:45381681-45381703 CTCTCAGTCCCTGCCTCACGGGG + Intergenic
1107941547 13:45381762-45381784 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1107941577 13:45381840-45381862 CTCTCAGTCCCTGCCTCGTTGGG + Intergenic
1107941603 13:45381920-45381942 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1107941632 13:45381999-45382021 CTCTGAGTCCCTGCCTCGTGGGG + Intergenic
1107941658 13:45382079-45382101 CTCTCAGTCCCTGCCTCGTGGGG + Intergenic
1107941688 13:45382158-45382180 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1107941719 13:45382236-45382258 CTCTCAGTCCCTGCCTCGTTGGG + Intergenic
1107941745 13:45382315-45382337 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1107941774 13:45382394-45382416 CTCTGAGTCCCTGCCTCGTGGGG + Intergenic
1107941800 13:45382474-45382496 CTCTGAGTCTCCGCCTCGCGGGG + Intergenic
1107942109 13:45383969-45383991 CTCTCAGTCCCTGCCTCGTGGGG + Intergenic
1108053009 13:46464114-46464136 CTCTCAGTCCCTGCCTCGTGGGG - Intergenic
1108053039 13:46464193-46464215 CTCTCAGTCCCTGCCTCGTGGGG - Intergenic
1108053070 13:46464271-46464293 CTCTCAGTCCCTGCCTTGTTGGG - Intergenic
1108053097 13:46464349-46464371 CTCTCGGTCCCTGCCTTGTTGGG - Intergenic
1108053129 13:46464428-46464450 CTCTGAGTCCCCGCCTCGTTGGG - Intergenic
1108053160 13:46464507-46464529 CTCTGAGTCCCCGCCTCGTGGGG - Intergenic
1108053193 13:46464588-46464610 CTCTCAGTCCCCACCTCGCTGGG - Intergenic
1108053374 13:46465433-46465455 CTTTCAGTCCCCGCCTCGCAGGG - Intergenic
1108053398 13:46465512-46465534 CTCTCAGTCCCCGCCACACGGGG - Intergenic
1108053427 13:46465591-46465613 CTCTCGGTCCCTGCCTCGTGGGG - Intergenic
1108053459 13:46465678-46465700 CTCTCAGTCCCTGCCTCGTGGGG - Intergenic
1108053493 13:46465757-46465779 CTCTCAGTCCCCGCCTCGCCGGG - Intergenic
1108053807 13:46467268-46467290 CTCTCAGTCCCCGCCTCGCAGGG - Intergenic
1108053832 13:46467348-46467370 CTCTCAGTCCCTGCCTCGTGGGG - Intergenic
1108053863 13:46467428-46467450 CTCTGCGTCCCTGCCTCGTGGGG - Intergenic
1108053892 13:46467507-46467529 CTCTCAGTCCCCGCCTCGTGGGG - Intergenic
1108053917 13:46467587-46467609 CTCTCAGTCCCTGCCTCGTTGGG - Intergenic
1108818210 13:54316127-54316149 CTCTTACTCCCTGTATCGCGGGG - Intergenic
1109537144 13:63737562-63737584 CTGTCAGTCCCCGCCTCCCGGGG + Intergenic
1109537174 13:63737642-63737664 CTTTCAGTACCCGCCTCGCGGGG + Intergenic
1109537202 13:63737722-63737744 CTCTCTGTCCCCTCGTCGCGGGG + Intergenic
1109537480 13:63739081-63739103 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1109537535 13:63739243-63739265 CTCTCAGTCCCCGCTTCGCGAGG + Intergenic
1109537566 13:63739323-63739345 CTCTCAATCCCCGCCTCGCGGGG + Intergenic
1109537613 13:63739482-63739504 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1109537922 13:63740973-63740995 CTCTCAGTCCCTGTCTCACGGGG + Intergenic
1109537950 13:63741051-63741073 CTGTCAGTCCCTCCCTCGTGGGG + Intergenic
1109537979 13:63741131-63741153 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1109538029 13:63741290-63741312 CTCTGAGTTCCCGCCTCGCGGGG + Intergenic
1109538079 13:63741448-63741470 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1109538103 13:63741528-63741550 CACTCAGTCCCGGCCTCGTGGGG + Intergenic
1109538148 13:63741686-63741708 CTCTGAGTCCCCGCCTCGCGGGG + Intergenic
1109538202 13:63741844-63741866 CTCTCAGTCCCTTCCTCGCGGGG + Intergenic
1109538228 13:63741924-63741946 CTCTCAGTCGCCGCCTCGCGGGG + Intergenic
1109538278 13:63742081-63742103 CTCTGAGTCCCTGCCTCTCGGGG + Intergenic
1109538329 13:63742241-63742263 TTCTCAGTCCCTGCCTCAGTGGG + Intergenic
1109545510 13:63837531-63837553 TTCTCAGTCCCTGCCTCAGTGGG - Intergenic
1109545560 13:63837691-63837713 CTCTGAGTCCCTGCCTCTCGGGG - Intergenic
1109545609 13:63837848-63837870 CTCTCAGTAGCCGCCTCGCGGGG - Intergenic
1109545634 13:63837928-63837950 CTCTCAGTCCCTTCCTCGCGGGG - Intergenic
1109545662 13:63838007-63838029 CTCTCAGTCCCCGCCTCACGGGG - Intergenic
1109545871 13:63838915-63838937 CTGTCAGTCCCTCCCCCGTGGGG - Intergenic
1109546213 13:63840487-63840509 CTCTCAGTCCCCGCCTCGTGGGG - Intergenic
1109546262 13:63840644-63840666 CTGTCAGTCCCCGCCTCGCGGGG - Intergenic
1109546288 13:63840721-63840743 CTGTCAGTCCCCGCCTCGCGGGG - Intergenic
1109546317 13:63840802-63840824 CTCTCAGTTCCTGCCTGGCGGGG - Intergenic
1109546364 13:63840960-63840982 CTCTCAATCCTCGGCTCGCGGGG - Intergenic
1109546393 13:63841040-63841062 CTGTCAGTACCCGCCTCGCGGGG - Intergenic
1109546421 13:63841117-63841139 CTCTCAGTCCCCGCTTCGCGGGG - Intergenic
1109546471 13:63841276-63841298 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1109546495 13:63841356-63841378 AACTCAGTCCCCGCCTCGTGGGG - Intergenic
1109546688 13:63842258-63842280 CTCTCAGTCCTCGGCTCGCGGGG - Intergenic
1109546715 13:63842337-63842359 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1109546737 13:63842415-63842437 CTCTCAGTCCCCGCCTCGTGGGG - Intergenic
1109546762 13:63842494-63842516 CTCTCAGTCCCTGCCTCGCGGGG - Intergenic
1109547064 13:63843986-63844008 CTCTCAGTCCCTGCCTCGCGGGG - Intergenic
1109547091 13:63844065-63844087 CTCTCTGTCCCCTCGTCGCGGGG - Intergenic
1109547114 13:63844143-63844165 AACTCAGTCCCCGCCTCGCGGGG - Intergenic
1109547134 13:63844223-63844245 CTCTTACTCCCTGCCTCGCGGGG - Intergenic
1109840841 13:67914851-67914873 CTCTTACTCCCCGCATCGCGGGG - Intergenic
1110410406 13:75198560-75198582 TTCTCACTGCCTGCCTCTCGAGG - Intergenic
1110836964 13:80094066-80094088 CGCTCAGTCACTGCCTCCCTTGG + Intergenic
1110891539 13:80704382-80704404 CTCTCAATCCCTGCCTCGCGGGG - Intergenic
1110891648 13:80704702-80704724 CTCTCAGTTCCCGCCTCACAGGG - Intergenic
1110891798 13:80705450-80705472 CTCTCAGTCCCCGCCTCGTGGGG - Intergenic
1110891818 13:80705530-80705552 CTCTCAGTACCCGCCTAGTGGGG - Intergenic
1110891894 13:80705764-80705786 CTCTCCATCCCCGCCTCGCGAGG - Intergenic
1110891947 13:80705922-80705944 CTCTGAGTCCCCGCCTCACGGGG - Intergenic
1110891979 13:80706001-80706023 CTCTTAGTCCCCACCTCGCTGGG - Intergenic
1110892007 13:80706080-80706102 CTCTCAGTCCCTACCTCATGGGG - Intergenic
1110892020 13:80706119-80706141 CTCTCAGTCCCCGCGTCGTGGGG - Intergenic
1110892048 13:80706199-80706221 CTCTCAGTCCCTGCCTCGCGGGG - Intergenic
1110892073 13:80706278-80706300 GGCTGAGTCCCTGCCTCGCGGGG - Intergenic
1110892104 13:80706355-80706377 CTCTCAGTCCCCACCTTGCGGGG - Intergenic
1110892279 13:80707181-80707203 CTCTCAGTCCCTGCCTCGCGGGG - Intergenic
1110892306 13:80707261-80707283 CTCTCAGTCCACACCTCACGGGG - Intergenic
1110892359 13:80707422-80707444 CTCTCAGTCCCCGCCTCGCAGGG - Intergenic
1110892468 13:80707743-80707765 TTCTCAGTCCCCGCCTCGGAGGG - Intergenic
1110892496 13:80707822-80707844 CTCTCAGTACCCGCCTCGCGGGG - Intergenic
1112486839 13:99827628-99827650 CTCTCAGCCCCTGCCACCTGGGG + Intronic
1117037737 14:51744803-51744825 CTCTTACTCCCCGCATCGCGGGG - Intergenic
1117790329 14:59333433-59333455 GTCACAGTCCCTGCCACGTGAGG - Intronic
1122428041 14:101623092-101623114 CTTTCTGTACCTGCCTCACGGGG - Intergenic
1122797259 14:104212288-104212310 CACTCACTCCCTCCCTCGGGTGG - Intergenic
1122809143 14:104279367-104279389 CGCCCACTCCCTGCCTGGCGCGG - Intergenic
1127683224 15:61317310-61317332 ATCCCAATCCCTGCCTCGCTGGG + Intergenic
1128212977 15:65915266-65915288 CTCTCAGTCACAGCCTCCCTAGG - Intronic
1129368000 15:75068788-75068810 CACCCAGTCCCTGCCTCACTGGG - Intronic
1129965336 15:79729916-79729938 CTCTCAATCCCTGCATCCCCAGG - Intergenic
1133119260 16:3596204-3596226 CGCTCAGTCCCTCCCTCGCCAGG + Exonic
1134111081 16:11515931-11515953 TTCTCAGGCCCTGCCTGGAGTGG - Exonic
1136599565 16:31275831-31275853 CTCCCAGTCCCAGCCTCACTTGG + Intronic
1143885837 17:10064201-10064223 CTCACAGTCCCTGCGTGTCGTGG - Intronic
1147741566 17:42673481-42673503 CGCTCAGCCTCTGCCTGGCGTGG + Exonic
1151505168 17:74522636-74522658 ATCTCAGTCACTGCATCCCGAGG + Exonic
1151983814 17:77529261-77529283 CTCTCTATCCCTGGCTGGCGTGG + Intergenic
1152659714 17:81536613-81536635 CTCTTCGTCCTTGCCTGGCGGGG - Exonic
1153551796 18:6270357-6270379 CTCTCAGTACCTGCTTTGCCTGG - Intronic
1164692537 19:30222196-30222218 CTCGCTGCCCCTGCCTCGCCTGG - Intergenic
1165076678 19:33283301-33283323 CACCCAGTCCCTGCCTTGGGTGG - Intergenic
1166375455 19:42324730-42324752 CCCTCAGCCCCTGCCCCGAGCGG + Exonic
1168155362 19:54471306-54471328 CTCTCAGTCCCGGCCCCGCCAGG + Intronic
1168641507 19:58034392-58034414 CCCCCAGTCCCCGCCCCGCGTGG - Intronic
925169429 2:1741966-1741988 CCCTCAGTCCCTGCCTCCCCAGG + Intronic
925287977 2:2728323-2728345 ATCTCTGTCCCTGCCAGGCGTGG + Intergenic
925362758 2:3290923-3290945 CTCTCAGTCCTGGCCTGGCCTGG - Intronic
928012836 2:27627055-27627077 CTTGCAGTCTCTGCCTCGCCTGG + Exonic
929646856 2:43637137-43637159 CTCCCAGTCCCTGCCCCAGGAGG - Intergenic
933457236 2:82531064-82531086 CTCTTAGTCCCCGCATCGCGGGG + Intergenic
935763508 2:106342880-106342902 CTCACACTCCCTGCCTCTCGAGG + Intergenic
936151052 2:110022690-110022712 CTCTCAGTCCCTGCCTCGGCTGG - Intergenic
936193625 2:110348679-110348701 CTCTCAGTCCCTGCCTCGGCTGG + Intergenic
936557941 2:113512119-113512141 CTCTCAGTCTCCGCCTCGCGAGG + Intergenic
936972501 2:118188662-118188684 GCCACAGTCCCTGCCTCGAGGGG - Intergenic
937986487 2:127640422-127640444 CTCCCAGGCCCTGCCTCCCAGGG + Intronic
941671811 2:168301717-168301739 CTCTGAGTCCCTGGCTGGCATGG + Intergenic
944461630 2:199955837-199955859 CTCTCGGTCGCTGCCCTGCGGGG + Exonic
946322570 2:218962184-218962206 CTCCCACTCCCTCCCTCCCGGGG - Intergenic
1175686492 20:61032036-61032058 CTCTCTGTCTCTGCCTCTCTTGG - Intergenic
1176054094 20:63135123-63135145 CTCTAAGGCCCTGCCTCCCCTGG - Intergenic
1178673833 21:34614662-34614684 CGCCCAGTCCCGGCCGCGCGCGG - Intronic
1181094605 22:20496565-20496587 CGCTCATTCCCTCCCTCCCGCGG + Intronic
1183116617 22:35697346-35697368 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1183402557 22:37613218-37613240 CCCTCATTCTCTGCCTCGTGTGG + Intronic
1183856158 22:40636467-40636489 CTCTCACTCACCGCCTCGCGCGG + Exonic
949883109 3:8676799-8676821 CTCTCAGTCCCCGCCTCACTGGG - Intronic
949883137 3:8676878-8676900 CTCTCTGTCCCCGCCTCACGGGG - Intronic
949883167 3:8676959-8676981 CTCTCAGTCCCCGCCTCACAGGG - Intronic
949883194 3:8677039-8677061 CTCGCAGTCCCCGCCTCCTGGGG - Intronic
949883219 3:8677119-8677141 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
949883469 3:8678503-8678525 CTCTCAGTCCCCGCCTCGCGGGG - Intronic
949883494 3:8678582-8678604 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
949883525 3:8678661-8678683 CTCTCAATCCCCGCCTCGCGGGG - Intronic
949883577 3:8678823-8678845 TTCTCAGTCCCCGCCTCGTGGGG - Intronic
949883604 3:8678905-8678927 CTCTCAGTCCCCGCCTGGCGGGG - Intronic
949883628 3:8678985-8679007 CTCTCAGTCCCCACCTCGCGGGG - Intronic
949883654 3:8679064-8679086 CTCTCAGTCCCCGCCTCGCGGGG - Intronic
949883679 3:8679141-8679163 CTCTCAGTCCCCGCCTCGCGGGG - Intronic
949883733 3:8679298-8679320 CTCTTAGTCCCCGCCTCATGGGG - Intronic
949883760 3:8679379-8679401 CTCTCAGTCCCCTCCTCCTGGGG - Intronic
949883793 3:8679459-8679481 TTCTCAGTCCCCGCCTCCCGGGG - Intronic
949883848 3:8679618-8679640 CTCTCATTCCCCGCCTCACCGGG - Intronic
949884117 3:8681097-8681119 CTCTCAGAACCCGCCTCGCGGGG - Intronic
949884146 3:8681177-8681199 CTCTCATTCCCCGCCTTGCATGG - Intronic
949884171 3:8681254-8681276 CTGTCAGTCCCTGCCTCACGGGG - Intronic
949884198 3:8681333-8681355 CTCTCAGTCCCCGAGCCGCGGGG - Intronic
949884222 3:8681412-8681434 CTCTCAGTCCCGGGCTCGCCGGG - Intronic
949884251 3:8681490-8681512 CTCTCAGTCCCCGCCTCGTGGGG - Intronic
949884280 3:8681567-8681589 CTCTCAGTCCCCGCTTCGTTGGG - Intronic
949884335 3:8681724-8681746 CTCTCACTCCCCGCCTCCCAGGG - Intronic
950670909 3:14524916-14524938 CTCTCAGTCACTGCCTCCCTGGG - Intronic
956316240 3:67940809-67940831 CTTTCAGTTCCTGCCTGGCAGGG - Intergenic
957077297 3:75612075-75612097 CTTTCACTCCCTGCATCGCGGGG + Intergenic
957077328 3:75612158-75612180 CTCTCACTCCCCGCATCGCGGGG + Intergenic
961274463 3:125715996-125716018 CTCTGACTCCCTGCATAGCGGGG - Intergenic
961277401 3:125738629-125738651 CTCTTACTCCCCGCATCGCGGGG - Intergenic
961877025 3:130031039-130031061 CTCTTACTCCCCGCATCGCGGGG + Intergenic
962323067 3:134407113-134407135 CTCTAAGTGCCTGCCCCGCTTGG - Intergenic
963055261 3:141181496-141181518 CTCTCAGTCCCTACTTCCCTGGG + Intergenic
963397905 3:144757112-144757134 GTCCCAATCCCTGCCCCGCGGGG - Intergenic
965495243 3:169390093-169390115 CTCTCAGCCTCTGCCTCTCAAGG - Intronic
968620785 4:1602676-1602698 CTCGCAGCTCCTGCCTGGCGGGG - Intergenic
968755033 4:2411155-2411177 CTCTAAGTCTCTGCCACGGGTGG - Intronic
968989303 4:3898229-3898251 CTCTTACTCCCCGCATCGCGGGG + Intergenic
969025867 4:4171807-4171829 CTCTTACTCCTTGCATCGCGGGG + Intergenic
969730878 4:8956918-8956940 CTCTTACTCCCCGCATCGCGGGG - Intergenic
969730910 4:8956999-8957021 CTCTTACTCCCCGCATCGCGGGG - Intergenic
969731206 4:8959153-8959175 CTCTTACTCCCCGCATCGCGAGG - Intergenic
969785032 4:9450827-9450849 CTCTTACTCCCCGCATCGCGGGG - Intergenic
969790498 4:9491104-9491126 CTCTTACTCCCCGCATCGCGGGG - Intergenic
969790525 4:9491187-9491209 CTCTTACTCCCCGCATCGCGGGG - Intergenic
969790840 4:9493340-9493362 CTCTTACTCCCCGCATCGCGGGG - Intergenic
969792743 4:9503261-9503283 CTCTTACTCCCCGCATCGCGGGG - Intergenic
969826008 4:9758882-9758904 CTCTTACTCCCCGCGTCGCGGGG - Intergenic
972326645 4:38022658-38022680 CTCTCACTTCCTGCCTCAGGTGG - Intronic
974741685 4:66014702-66014724 CTCTCACTCACTGCCTCCCTTGG + Intergenic
978385536 4:108172722-108172744 CCCTGCGTCCCTGCCTCGCTGGG + Intergenic
981044756 4:140254409-140254431 CGCTCAGTCCCTGCATCCCAGGG - Intergenic
982057583 4:151568445-151568467 CTCTCAGTCTCTGCCTACAGAGG + Intronic
985113717 4:186571412-186571434 ATCTCTCTCCCTGCCTGGCGTGG - Intergenic
990905120 5:60795218-60795240 CTCTCAGTACCTTCCTCTCGGGG - Intronic
996629168 5:125607067-125607089 CTCTCAGCCCCTGGCTGGCTAGG + Intergenic
1000354396 5:160379816-160379838 CTCTCAGTCCCAGCTCCGTGGGG + Intergenic
1002133422 5:177094740-177094762 TTCTCAATCCCTGCCTCCCAGGG - Intronic
1002631300 5:180581303-180581325 ATCTCAATTCCTGCCTCGTGTGG + Intergenic
1002640140 5:180626834-180626856 CTCTCACTGCCTGCCTCGCTGGG + Intronic
1006199137 6:32270722-32270744 CTCTCACTCCCCGCATCGCGGGG - Intergenic
1006516737 6:34549651-34549673 CTCTCAGGCCCTACCTCCTGGGG + Intronic
1007593456 6:43037419-43037441 CTCTCAATCTCTGCCTAGAGGGG + Intergenic
1014205545 6:118651678-118651700 CCCGCAGTCCCCGCCCCGCGCGG - Intronic
1019635988 7:2075986-2076008 CTCTCAGAGCCTGTCTCCCGCGG - Intronic
1024228226 7:47344698-47344720 CACTCAGGCGCTGCATCGCGGGG - Intronic
1026099272 7:67371289-67371311 CACTCAGTACCTGCCTGGCCAGG - Intergenic
1031171019 7:118291731-118291753 CACTGAGTCCCTCCCACGCGGGG - Intergenic
1034303175 7:150033655-150033677 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034303228 7:150033816-150033838 CTCTCAGTCCCTGCCTCGTGGGG + Intergenic
1034303252 7:150033896-150033918 CTCTCAGTCCCCGCGTCGCGAGG + Intergenic
1034303283 7:150033973-150033995 TTCGCAGTCCCCGCCTCGGGGGG + Intergenic
1034303311 7:150034052-150034074 CTCTGAGTCCCCGCCTCGCGGGG + Intergenic
1034303460 7:150034795-150034817 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1034303487 7:150034875-150034897 CTCTCAGTCCCTACCTCGCGGGG + Intergenic
1034303575 7:150035183-150035205 CTCTCAGTCCCCGCCTCACGGGG + Intergenic
1034303657 7:150035426-150035448 CTCTCAGTCCCTGACTCGCGGGG + Intergenic
1034303737 7:150035731-150035753 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1034303764 7:150035812-150035834 CTCTCAGTCCCTGCCTTGCGGGG + Intergenic
1034303818 7:150035974-150035996 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034303840 7:150036053-150036075 CTCTCAGTCCCCGCGTCGCGAGG + Intergenic
1034303870 7:150036132-150036154 CTCTGAGTCCCCGCCTCGTGGGG + Intergenic
1034304024 7:150036883-150036905 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1034304052 7:150036964-150036986 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034304110 7:150037126-150037148 CTCTCAGTCCCTGCCTCGTGGGG + Intergenic
1034304169 7:150037352-150037374 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1034304196 7:150037433-150037455 CTCTCAATCCCTGCCTCGCGGGG + Intergenic
1034304341 7:150037901-150037923 CTCTCAGTCCCCGCGTCGCGAGG + Intergenic
1034304395 7:150038058-150038080 CTCTGAGTCCCCACCTCGCGGGG + Intergenic
1034304541 7:150038780-150038802 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1034304571 7:150038861-150038883 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034304655 7:150039170-150039192 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1034304685 7:150039251-150039273 CTCTCAATCTCTGCCTCGGGGGG + Intergenic
1034304740 7:150039411-150039433 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034304863 7:150039797-150039819 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034304888 7:150039877-150039899 CTCTCAGTCCCCGTGTCGTGAGG + Intergenic
1034304913 7:150039955-150039977 TTCGCAGTCCCCGCCTCGCGGGG + Intergenic
1034304937 7:150040034-150040056 CTCTGAGTCCCCGCCTCGCGGGG + Intergenic
1034305086 7:150040780-150040802 CTCTCAGTCCCCGCCTTGCGGGG + Intergenic
1034305231 7:150041527-150041549 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1034305261 7:150041608-150041630 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034305321 7:150041771-150041793 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034305406 7:150042078-150042100 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034305435 7:150042159-150042181 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034305494 7:150042321-150042343 CTCTCAGTCCCTGCCTCGCGGGG + Intergenic
1034305519 7:150042401-150042423 CTCTCAGTCCCCGCGTCGCGAGG + Intergenic
1034305544 7:150042479-150042501 TTCGCAGTCCCCGCCTCGCGGGG + Intergenic
1034305570 7:150042558-150042580 CTCTGAGTCCCCGCCTCGCGGGG + Intergenic
1034305718 7:150043304-150043326 CTCTCAGTCCCCGCCTTGCGGGG + Intergenic
1034801125 7:154057346-154057368 CTCTCAGTCCCCGCCTCGCGGGG - Intronic
1034801274 7:154058094-154058116 CTCTGAGTCCCCGCCTCATGGGG - Intronic
1034801304 7:154058174-154058196 TTCGCAGTCCCCGCCTCGCGGGG - Intronic
1034801333 7:154058252-154058274 CTCTCAGTCCCCGCATCACGAGG - Intronic
1034801357 7:154058332-154058354 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
1034801439 7:154058574-154058596 CTCTCAGTCCCCGCCTCGCGGGG - Intronic
1034801551 7:154058962-154058984 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
1034801579 7:154059042-154059064 CTCTCAGTCCCCGCCTCGTGGGG - Intronic
1034801632 7:154059204-154059226 CTCTCAGTCCCTACCTCGCGGGG - Intronic
1034801659 7:154059284-154059306 CTCTCAGTCCCCGCCTCAAGGGG - Intronic
1034801809 7:154060026-154060048 CTCTGAGTCCCCGCCTCGCGGGG - Intronic
1034801864 7:154060182-154060204 CTCTCAGTCCCCGTGTCGTGAGG - Intronic
1034801888 7:154060262-154060284 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
1034801917 7:154060342-154060364 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
1034801947 7:154060423-154060445 CTCGCAGTCCCCGCCTCGCGGGG - Intronic
1034802031 7:154060730-154060752 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
1034802057 7:154060810-154060832 CTCTCAGTCCCTGCCTCATGGGG - Intronic
1034802082 7:154060890-154060912 CTCTCAGTCCCCGCCTCGTGGGG - Intronic
1034802258 7:154061712-154061734 TTCGCAGTCCCCGCCTCGCGGGG - Intronic
1034802285 7:154061790-154061812 CTCTCAGTCCCCGCGTCGCGAGG - Intronic
1034802309 7:154061870-154061892 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
1034802367 7:154062031-154062053 CTGTCAGTCCCTGCCTCGCGGGG - Intronic
1034802396 7:154062112-154062134 CTCTCAGTCCCCGCCTCGCGGGG - Intronic
1034802626 7:154062824-154062846 CTCGCAGTCCCCGCCTCGCGGGG - Intronic
1034802738 7:154063213-154063235 CTCTCAGTCCCTGCCTCGCGGGG - Intronic
1034802768 7:154063293-154063315 CTCTCAGTCCCCGCCTCATGGGG - Intronic
1034802869 7:154063614-154063636 CTCTCAGTCCCTGCCTCGTGGGG - Intronic
1036833959 8:12043088-12043110 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1036855805 8:12289653-12289675 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1038026666 8:23596943-23596965 CCCTCAGACCCTGCCTCACCTGG - Intergenic
1049188297 8:141270948-141270970 TTCTGAGTCCCTGTCTCGCCAGG - Intronic
1052389716 9:27865384-27865406 CTCTCATTTCCTGCCTCTCAAGG + Intergenic
1053736121 9:41104143-41104165 CTCTCAGTCTCCGCCTCGCGAGG - Intergenic
1053736145 9:41104222-41104244 CTGTCAGTCCCCTCCTCGCGGGG - Intergenic
1053736203 9:41104603-41104625 CTCTCAGTCACCGCCTCGCGGGG - Intergenic
1053736230 9:41104683-41104705 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1053736256 9:41104763-41104785 CTCTGAGACCCCGCCTCGCGGGG - Intergenic
1053736283 9:41104842-41104864 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1053736545 9:41106615-41106637 GGCTCAGTCCCCGCCTTGCGGGG - Intergenic
1053736573 9:41106693-41106715 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1053736622 9:41106853-41106875 CTCTCAGTCCCCGCCTCGCGAGG - Intergenic
1053736644 9:41106932-41106954 CTCTGAGTCCTTGCCTCGCGGGG - Intergenic
1053736666 9:41107012-41107034 CTCTAATTCCGCGCCTCGCGAGG - Intergenic
1053736691 9:41107089-41107111 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1053736730 9:41107194-41107216 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1053736759 9:41107270-41107292 CTGTCAGTCCCCGCCACGCGGGG - Intergenic
1053736785 9:41107349-41107371 CTCTCAGTCCCCGCCTCACGGGG - Intergenic
1053736811 9:41107429-41107451 CTCTTAGACACCGCCTCGCGGGG - Intergenic
1053736836 9:41107507-41107529 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1053736981 9:41108256-41108278 CTCTCTGTCCCCGCCTCGCCGGG - Intergenic
1053737033 9:41108416-41108438 CTCTCAGTCCCCACCTCGCGAGG - Intergenic
1053737057 9:41108496-41108518 TTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1053737085 9:41108576-41108598 CTCTCAGTCCACGCCTCGTGGGG - Intergenic
1053737115 9:41108655-41108677 CTCTCAGTCCCCTCCTCCCGGGG - Intergenic
1053737204 9:41108897-41108919 CTCGCAGTCCCTGTCTCGCGGGG - Intergenic
1053737231 9:41108976-41108998 CTCTCAGTCCCCGCCTCGCGGGG - Intergenic
1053737259 9:41109055-41109077 CTCTTATTCCCCGACTCGCGAGG - Intergenic
1054456143 9:65431425-65431447 CCCTCACTCCCTGCCTGGCCCGG + Intergenic
1054691091 9:68322264-68322286 CTCTTATTCCCCGACTCGCGAGG + Intergenic
1054691118 9:68322343-68322365 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054691145 9:68322422-68322444 CTCGCAGTCCCTGTCTCGCGGGG + Intergenic
1054691233 9:68322662-68322684 CTCTCAGTCCCCTCCTCCCGGGG + Intergenic
1054691263 9:68322741-68322763 CTCTCAGTCCACGCCTCGTGGGG + Intergenic
1054691291 9:68322821-68322843 TTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054691315 9:68322901-68322923 CTCTCAGTCCCCACCTCGCGAGG + Intergenic
1054691341 9:68322981-68323003 CTGTCAGTCCCCACCTCGCGAGG + Intergenic
1054691393 9:68323141-68323163 CTCTCTGTCCCCGCCTCGCCGGG + Intergenic
1054691537 9:68323890-68323912 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054691562 9:68323968-68323990 CTCTTAGACACCGCCTCGCGGGG + Intergenic
1054691588 9:68324048-68324070 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054691614 9:68324127-68324149 CTGTCAGTCCCCGCCACGCGGGG + Intergenic
1054691643 9:68324206-68324228 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054691680 9:68324311-68324333 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054691706 9:68324389-68324411 CTCTAATTCCGCGCCTCGCGAGG + Intergenic
1054691728 9:68324469-68324491 CTCTGAGTCCTTGCCTCGCGGGG + Intergenic
1054691749 9:68324547-68324569 CTCTCAGTCCCCGCCTCGCGAGG + Intergenic
1054691798 9:68324707-68324729 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054691826 9:68324785-68324807 GGCTCAGTCCCCGCCTTGCGGGG + Intergenic
1054692090 9:68326558-68326580 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054692117 9:68326637-68326659 CTCTGAGACCCCGCCTCGCGGGG + Intergenic
1054692144 9:68326717-68326739 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1054692171 9:68326797-68326819 CTCTCAGTCACCGCCTCGCGGGG + Intergenic
1054692229 9:68327178-68327200 CTGTCAGTCCCCTCCTCGCGGGG + Intergenic
1054692253 9:68327257-68327279 CTCTCAGTCTCCGCCTCGCGAGG + Intergenic
1056864797 9:90219885-90219907 CTCTCAGTCCCCGCATCGCGGGG - Intergenic
1056918230 9:90763001-90763023 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1056918258 9:90763080-90763102 CTCTTACTCCCCGCATCGCGGGG + Intergenic
1058456976 9:105146934-105146956 CTCTCAGTCCCAGCATCACAGGG + Intergenic
1060591682 9:124820836-124820858 CTGTCTGTTCCTGCCTCACGGGG - Intergenic
1061040430 9:128138440-128138462 CTCTCAGTCCCCGCCTCTCGGGG + Intergenic
1061040486 9:128138600-128138622 CTCTCAGGCACCGCCTCGCGGGG + Intergenic
1061040514 9:128138678-128138700 CTCTCAGTCTCCGCCTCGCGGGG + Intergenic
1061040542 9:128138758-128138780 CTGTCAGTCCCCGCCTCGCGGGG + Intergenic
1061040568 9:128138837-128138859 CTCTCAGTCCCCGCCTCGTGGGG + Intergenic
1061040599 9:128138918-128138940 CTCTCAGTCCCCGCCTCGCGGGG + Intergenic
1061040627 9:128138997-128139019 CTCTCAGTCCCCGCCATGCTGGG + Intergenic
1061040651 9:128139074-128139096 CTCTCAGTCGCCGACTCCCGGGG + Intergenic
1061040705 9:128139235-128139257 CTCTGAGTCCCCGCCTCGCGGGG + Intergenic
1061040761 9:128139394-128139416 CTGTCAGTTCCCGCCTAGCGGGG + Intergenic
1061040810 9:128139554-128139576 CTCTCAGTCCCCGCCTCACGGGG + Intergenic
1061040838 9:128139636-128139658 CTGTCAGTCCCCGCCTCGCGGGG + Intergenic
1061040866 9:128139716-128139738 CTCCCAGTCCCCAACTCGCGGGG + Intergenic
1061811230 9:133163689-133163711 CACCCAGTCCCTGCCACGCAAGG - Intronic
1062509279 9:136895974-136895996 CTGTCAGTCCCTGCCTCCCTGGG + Intronic
1186168596 X:6853632-6853654 CTCCCAGTCCCTCACTCCCGAGG + Intergenic
1189310426 X:40014080-40014102 CTCTCAGTCGCTGTCACCCGAGG - Intergenic
1189371830 X:40434889-40434911 CCCTGAGTCACTGCCTCGCAGGG + Intergenic
1189652400 X:43204092-43204114 CTATCAGTCACTGCCTCCCTTGG + Intergenic
1192498650 X:71633904-71633926 AGCTCAGGCCCTGCCTCTCGTGG + Intergenic
1196151765 X:112382114-112382136 CTTGCAGTCTCTGCCTCGCCCGG - Intergenic
1197489626 X:127101200-127101222 CTCTCAGTCCCTCTCTCACCTGG - Intergenic
1199049933 X:143225236-143225258 CTGCCAGTCCCTGCCTCTCCTGG - Intergenic
1199664000 X:150082241-150082263 CTCTCTTTCCCTGCCTAGCCTGG + Intergenic
1199806287 X:151304020-151304042 CTCTCATTCTCTGCCTCCAGTGG - Intergenic