ID: 1109538080

View in Genome Browser
Species Human (GRCh38)
Location 13:63741449-63741471
Sequence TCTCAGTCCCTGCCTCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 30, 1: 79, 2: 108, 3: 99, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109538071_1109538080 7 Left 1109538071 13:63741419-63741441 CCTAAGAGCCAGTGGGGAAGAGG No data
Right 1109538080 13:63741449-63741471 TCTCAGTCCCTGCCTCGCGGGGG 0: 30
1: 79
2: 108
3: 99
4: 198
1109538067_1109538080 25 Left 1109538067 13:63741401-63741423 CCTCACTGAGATGGGGGTCCTAA No data
Right 1109538080 13:63741449-63741471 TCTCAGTCCCTGCCTCGCGGGGG 0: 30
1: 79
2: 108
3: 99
4: 198
1109538065_1109538080 27 Left 1109538065 13:63741399-63741421 CCCCTCACTGAGATGGGGGTCCT No data
Right 1109538080 13:63741449-63741471 TCTCAGTCCCTGCCTCGCGGGGG 0: 30
1: 79
2: 108
3: 99
4: 198
1109538064_1109538080 30 Left 1109538064 13:63741396-63741418 CCTCCCCTCACTGAGATGGGGGT No data
Right 1109538080 13:63741449-63741471 TCTCAGTCCCTGCCTCGCGGGGG 0: 30
1: 79
2: 108
3: 99
4: 198
1109538076_1109538080 -1 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538080 13:63741449-63741471 TCTCAGTCCCTGCCTCGCGGGGG 0: 30
1: 79
2: 108
3: 99
4: 198
1109538066_1109538080 26 Left 1109538066 13:63741400-63741422 CCCTCACTGAGATGGGGGTCCTA No data
Right 1109538080 13:63741449-63741471 TCTCAGTCCCTGCCTCGCGGGGG 0: 30
1: 79
2: 108
3: 99
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109538080 Original CRISPR TCTCAGTCCCTGCCTCGCGG GGG Intergenic
900094671 1:935446-935468 TCTCACTCCCTGCCTCAAAGGGG - Intronic
900363058 1:2299233-2299255 TGACTGTCCCTGCCTCGGGGAGG + Intronic
900532254 1:3160363-3160385 TCTCAGTCCCTGGCTGGGGGAGG + Intronic
900889023 1:5435846-5435868 TCACAGTCCTTGCCTGGAGGGGG + Intergenic
900959435 1:5909775-5909797 TCTCAGTCCCTGGCTCCAGGGGG - Intronic
901845637 1:11980460-11980482 TCACCTTCCCGGCCTCGCGGCGG - Exonic
902660228 1:17895771-17895793 TGTCAGCCCCTGCCTTGCTGTGG - Intergenic
907523553 1:55040376-55040398 TCCCAGTTTCTGCCTCGCCGCGG + Intronic
907524823 1:55047985-55048007 TCTCAGTCCCTGCCTGGACTGGG - Intronic
919992246 1:202716216-202716238 TCTCACTCCCTGCATCAAGGAGG - Intergenic
920065778 1:203268612-203268634 TCTCAGTCCCTGCCCCAGGCTGG - Intronic
920847675 1:209607416-209607438 ACTCAGTCTCTGCCTCCCAGAGG + Intronic
923154072 1:231260539-231260561 TCTCACTCACTTCCTCTCGGAGG - Exonic
1071086631 10:81874547-81874569 CCCCAGCCCCTGGCTCGCGGCGG + Intergenic
1073061323 10:100735497-100735519 TCTCACTCCCGGCCGCGCAGAGG - Intergenic
1074973925 10:118565564-118565586 TCTCAGGCCCTGGCTCTGGGGGG - Intergenic
1076224863 10:128765866-128765888 TCTCAGATCCTGCCTCACTGTGG + Intergenic
1076260437 10:129060645-129060667 TCTCAGTCCTTGCCTCTGGGAGG - Intergenic
1076503232 10:130953365-130953387 TCACAGTGCCTACCTGGCGGTGG + Intergenic
1076603024 10:131671214-131671236 CCTCAGTCCCTGCCTTGGGCTGG + Intergenic
1076686079 10:132199052-132199074 CCTGAGTCCCTGCATCGGGGCGG + Intronic
1076686090 10:132199085-132199107 CCTGAGTCCCTGCATCGGGGTGG + Intronic
1077298551 11:1837096-1837118 GCTCTGCCCCTGCCTCCCGGTGG - Intronic
1077576386 11:3387007-3387029 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1077576416 11:3387088-3387110 TCTTACTCCCTGCATCGCGGGGG + Intergenic
1077576509 11:3387475-3387497 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1081911161 11:46700737-46700759 CCTAAGTTCCTGCCTCGGGGAGG + Intergenic
1083811679 11:65110008-65110030 TGGCAGTCCCTGCCTGGAGGAGG + Intronic
1084014750 11:66371787-66371809 CCTCTGTCCCCGCCTCGGGGCGG - Exonic
1084228382 11:67732025-67732047 TATTAGTCCCCGCATCGCGGGGG + Intergenic
1084228405 11:67732103-67732125 TATTAGTCCCCGCATCGCGGGGG + Intergenic
1084228426 11:67732181-67732203 TATTAGTCCCAGCATCGCGGGGG + Intergenic
1084264097 11:67996098-67996120 TCTTACTCCCCGCATCGCGGGGG + Intronic
1084304403 11:68272104-68272126 TCTCAGGCCCCGCCTCCCCGGGG + Intergenic
1084784529 11:71434540-71434562 TCTCAGTCCCAGCCTCGGGAGGG - Exonic
1084806752 11:71584547-71584569 TCTTACTCCCCGCATCGCGGGGG - Intronic
1084808960 11:71600713-71600735 TCTTACTCCCCGCATCGCGGGGG - Intronic
1084809270 11:71602866-71602888 TCTTACTCCCCGCATCGCGGAGG - Intronic
1084843969 11:71884953-71884975 TCTTACTCCCTGCATCGTGGGGG - Intronic
1084846807 11:71907354-71907376 TCTTACTCCCCGCATCGCGGGGG - Intronic
1084889068 11:72227922-72227944 TCTCAGGCCCTGCCCTGTGGTGG + Intronic
1085818393 11:79766063-79766085 TCTCAGTCCCTGCCTCTGAATGG + Intergenic
1087415141 11:97845736-97845758 TCTCTGACCCTGCCTAGCTGTGG - Intergenic
1088882046 11:113980080-113980102 GCTCTGTCCCTGCCTCGCAGAGG + Intronic
1090425071 11:126601991-126602013 CCGCAGCCCCTGCCTCGCAGCGG - Intronic
1091718222 12:2794910-2794932 TCCCAGCCCCTCCCTCGCGGCGG + Intergenic
1092433058 12:8424251-8424273 TCTTACTCCCTGCATCGCGGGGG + Intergenic
1092436274 12:8449206-8449228 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1092537304 12:9402644-9402666 TCTCAGTCTCCGCCTCGCGGTGG - Intergenic
1092537359 12:9402802-9402824 TCTCAGTCCCCGCCTCGCTTGGG - Intergenic
1092537406 12:9402960-9402982 TCTCAGTCCCCGCCTCGCTGCGG - Intergenic
1092537454 12:9403119-9403141 TGTCAGTCCCTGCCTCGCTGGGG - Intergenic
1092537506 12:9403279-9403301 TCTCAGTCCCCGCCTCGCTGGGG - Intergenic
1092537532 12:9403361-9403383 TCTCAGTCCCCGCCTCACAGGGG - Intergenic
1092537556 12:9403439-9403461 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1092537588 12:9403520-9403542 TCTCAGTCCCCACCTCGCGGGGG - Intergenic
1092537751 12:9403942-9403964 TCTCAGTCCCCGCCTCGCATGGG - Intergenic
1092537775 12:9404022-9404044 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1092537798 12:9404102-9404124 TCTCAGTTCATGCCTCACAGCGG - Intergenic
1092537823 12:9404178-9404200 TCTCAGTCCCCGCCTCATGTGGG - Intergenic
1092537861 12:9404283-9404305 TCTCCGTCCCTGCCTCGCGGGGG - Intergenic
1092537884 12:9404361-9404383 TCTCAGTACCCGCCTCGCGTGGG - Intergenic
1092537906 12:9404442-9404464 TCTCAGTCCCCGCCTTGCATGGG - Intergenic
1092537930 12:9404519-9404541 TCTCAATCCCCGCCTCGCATGGG - Intergenic
1092537994 12:9404709-9404731 TGTCAGTCCCCGCCTCGCTGGGG - Intergenic
1092538017 12:9404789-9404811 TCTCAGAACCTGGCTCGCGGGGG - Intergenic
1092538039 12:9404868-9404890 TCTCAGTCTCTGCCTCGCGGGGG - Intergenic
1092538068 12:9404947-9404969 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1092538099 12:9405025-9405047 TCTCAGTCCCCGCCCCGTGGGGG - Intergenic
1092538149 12:9405183-9405205 TCTCAGTCCCAGCCTTGTAGGGG - Intergenic
1092538410 12:9405822-9405844 TCGCAGTCCCCGACTCGTGGGGG - Intergenic
1092538443 12:9405901-9405923 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1092538475 12:9405983-9406005 TCTCAGTCCCCGCCCCGTGGGGG - Intergenic
1092538527 12:9406142-9406164 TCTCAGTCCCAGCCTCGTAGGGG - Intergenic
1092538551 12:9406220-9406242 TCTCAGTCCCCGCCTCGTGGGGG - Intergenic
1092538617 12:9406507-9406529 TCTCAGTCCCTGCCTCGCGGGGG - Intergenic
1092538647 12:9406587-9406609 TCTCAGTCCCCGCCTCGTGTGGG - Intergenic
1092538672 12:9406667-9406689 TCTCCGTCCCTGCCTCGCGGGGG - Intergenic
1092538696 12:9406745-9406767 TCTCAGTACCTGCCTCGCGTGGG - Intergenic
1092538717 12:9406823-9406845 TCTCAGTCCCTGCCTCACGGGGG - Intergenic
1092538741 12:9406902-9406924 TCTCAGTCCCCGCCTCGCATGGG - Intergenic
1092538799 12:9407061-9407083 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1092538822 12:9407141-9407163 TCTCAGTCTCTGCCTCGCGGGGG - Intergenic
1092538849 12:9407221-9407243 TCTCAGTCCGTGCCTCACGGGGG - Intergenic
1092539100 12:9408633-9408655 ACTCAGTCCCCGCCTCGCGGGGG - Intergenic
1092556578 12:9567698-9567720 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1092556609 12:9567778-9567800 TCTCAGTCACTGCCTCGTGGGGG + Intergenic
1092556635 12:9567857-9567879 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1092556989 12:9569583-9569605 TCTCAGTCCGCGCCTCACGGGGG + Intergenic
1092557015 12:9569663-9569685 TCTCAGTCTCTGCCTCGCGGGGG + Intergenic
1092557036 12:9569743-9569765 GCTCAGTCCCCGCCTCGCATGGG + Intergenic
1092557074 12:9569864-9569886 TCTCAGTCCCCGCATCGCGTGGG + Intergenic
1092557102 12:9569943-9569965 TGTCAGTCCCCGCCTCGCGGAGG + Intergenic
1092557194 12:9570204-9570226 TCTCAGTCCCCACCTCGCGGGGG + Intergenic
1092557291 12:9570414-9570436 TTTCAGTCCCTGCCTCGCGGGGG + Intergenic
1092557320 12:9570496-9570518 TCTCAGTCCCCGCCTCGCTGGGG + Intergenic
1092557375 12:9570654-9570676 TCTCAGTCTCCGCCTCGCGGTGG + Intergenic
1094513903 12:31117255-31117277 TCTCAGTCTCCCCCTCGCGGTGG - Intergenic
1094513998 12:31117620-31117642 TCTCAGTTCCCGCCTCACGAGGG - Intergenic
1094514050 12:31117778-31117800 TCTCAGTCCCCGCCTCGCTGCGG - Intergenic
1094514074 12:31117858-31117880 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1094514149 12:31118094-31118116 TCTCAGTCCCCGCTTCGCGGGGG - Intergenic
1094514178 12:31118174-31118196 TCTCAGTCCCCGCCTCGCAGGGG - Intergenic
1094514233 12:31118331-31118353 TCTCAGTCCCCGCCTCGTGGGGG - Intergenic
1094514260 12:31118410-31118432 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1094514334 12:31118647-31118669 TCTCGATCCCCGCCTCTCGGGGG - Intergenic
1094514471 12:31119174-31119196 TCTCAGTCCGCGCCTCGCGGAGG - Intergenic
1094514500 12:31119254-31119276 TCTCAGTCCCCGAATCGCGTGGG - Intergenic
1094514527 12:31119334-31119356 TCTCAGTCCCCGCCTCGCGGTGG - Intergenic
1094514577 12:31119492-31119514 TCTCAGTCCCTGCCTCGCGGGGG - Intergenic
1094514603 12:31119572-31119594 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1094514632 12:31119654-31119676 TCTCAGTTCCTGCCTCGCAGGGG - Intergenic
1094514659 12:31119732-31119754 TCTCAGTCCCCGCCTCGTGTGGG - Intergenic
1094514688 12:31119812-31119834 TCTCCGTCCCTGCCTCTCGGGGG - Intergenic
1094514710 12:31119890-31119912 TCTCAGTACCCGCCTCGCGTGGG - Intergenic
1094514728 12:31119967-31119989 TGTCAGTCCCTGCCTGGCGGGGG - Intergenic
1094514803 12:31120204-31120226 TCTCAGTCCCCGCGTCGCGGAGG - Intergenic
1094514831 12:31120284-31120306 TCTCAGTCCCCGCATCGCGTGGG - Intergenic
1094514978 12:31120811-31120833 TCTCAGTCCCCGCTTCGCGGGGG - Intergenic
1094515008 12:31120893-31120915 TCTCAGTCCCCGCCTCTCAGGGG - Intergenic
1094515036 12:31120973-31120995 TCTCACTCCCCGCCTCGCGGGGG - Intergenic
1094515068 12:31121052-31121074 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1094515330 12:31122465-31122487 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1094515361 12:31122545-31122567 TCTCAGTCCCCCCCTCGCGGGGG - Intergenic
1094515450 12:31122782-31122804 TCTCAGTCCCTGCCTCGCGGGGG - Intergenic
1094515479 12:31122861-31122883 TCTCAATCCCCACCTCACGGGGG - Intergenic
1094515509 12:31122940-31122962 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1097043839 12:56172743-56172765 TGTCAGCCCCTGGCTCCCGGTGG - Intronic
1106301361 13:28469100-28469122 CCTCATTCCCTGCCTTTCGGAGG - Intronic
1107545160 13:41428006-41428028 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1107545189 13:41428088-41428110 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1107940212 13:45376523-45376545 TCTCAGTCCCTACCTCGTGGGGG + Intergenic
1107940373 13:45377282-45377304 TCTCAGTCCCCGCCTTGCTGGGG + Intergenic
1107940407 13:45377362-45377384 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1107940434 13:45377441-45377463 TCTCAGTCCCTGCCTTGTTGGGG + Intergenic
1107940463 13:45377519-45377541 TCTCAGTACCTGCCTCATTGGGG + Intergenic
1107940488 13:45377599-45377621 TCTCAGTCCCCACCTCGTGGGGG + Intergenic
1107940514 13:45377678-45377700 TCTGCGTCCCTGCCTCGTGGGGG + Intergenic
1107940540 13:45377758-45377780 TCTCAGTCCCTGCCTCGTGGGGG + Intergenic
1107940570 13:45377837-45377859 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1107940601 13:45377915-45377937 TCTCAGTCCCTGCCTCGTTGGGG + Intergenic
1107940631 13:45377994-45378016 TCTCAGTCCGTGCCTGGCGGGGG + Intergenic
1107941044 13:45380066-45380088 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1107941076 13:45380145-45380167 TCTCAGTCCCTGCCTCGTTGGGG + Intergenic
1107941102 13:45380223-45380245 TCTCAGTCCCAGCCTCGTGGGGG + Intergenic
1107941130 13:45380302-45380324 TCTGAGTCCCTGCCTCGTGGGGG + Intergenic
1107941160 13:45380381-45380403 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1107941190 13:45380458-45380480 TCTCAGTCCCTGCCTCGTTGGGG + Intergenic
1107941220 13:45380537-45380559 TCTCAGTCCGTGCCTGGCGGGGG + Intergenic
1107941382 13:45381282-45381304 TCTCAGTCCCTGCCTCCCGGGGG + Intergenic
1107941413 13:45381360-45381382 TCTCAGTCCCTGCCTCGTTGGGG + Intergenic
1107941459 13:45381518-45381540 TCTCAGTCCCCGCCTCGTAGGGG + Intergenic
1107941490 13:45381597-45381619 TCTGAGTCCCTGCCTCGTGGGGG + Intergenic
1107941519 13:45381682-45381704 TCTCAGTCCCTGCCTCACGGGGG + Intergenic
1107941548 13:45381763-45381785 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1107941578 13:45381841-45381863 TCTCAGTCCCTGCCTCGTTGGGG + Intergenic
1107941604 13:45381921-45381943 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1107941633 13:45382000-45382022 TCTGAGTCCCTGCCTCGTGGGGG + Intergenic
1107941659 13:45382080-45382102 TCTCAGTCCCTGCCTCGTGGGGG + Intergenic
1107941689 13:45382159-45382181 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1107941720 13:45382237-45382259 TCTCAGTCCCTGCCTCGTTGGGG + Intergenic
1107941746 13:45382316-45382338 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1107941775 13:45382395-45382417 TCTGAGTCCCTGCCTCGTGGGGG + Intergenic
1107941801 13:45382475-45382497 TCTGAGTCTCCGCCTCGCGGGGG + Intergenic
1107941823 13:45382554-45382576 TCTCAGTCCGTGCCTCGCAGAGG + Intergenic
1107942110 13:45383970-45383992 TCTCAGTCCCTGCCTCGTGGGGG + Intergenic
1108052930 13:46463824-46463846 TATTACTCCCTGCATCGCGGGGG - Intergenic
1108053008 13:46464113-46464135 TCTCAGTCCCTGCCTCGTGGGGG - Intergenic
1108053038 13:46464192-46464214 TCTCAGTCCCTGCCTCGTGGGGG - Intergenic
1108053069 13:46464270-46464292 TCTCAGTCCCTGCCTTGTTGGGG - Intergenic
1108053096 13:46464348-46464370 TCTCGGTCCCTGCCTTGTTGGGG - Intergenic
1108053128 13:46464427-46464449 TCTGAGTCCCCGCCTCGTTGGGG - Intergenic
1108053159 13:46464506-46464528 TCTGAGTCCCCGCCTCGTGGGGG - Intergenic
1108053192 13:46464587-46464609 TCTCAGTCCCCACCTCGCTGGGG - Intergenic
1108053373 13:46465432-46465454 TTTCAGTCCCCGCCTCGCAGGGG - Intergenic
1108053397 13:46465511-46465533 TCTCAGTCCCCGCCACACGGGGG - Intergenic
1108053426 13:46465590-46465612 TCTCGGTCCCTGCCTCGTGGGGG - Intergenic
1108053458 13:46465677-46465699 TCTCAGTCCCTGCCTCGTGGGGG - Intergenic
1108053492 13:46465756-46465778 TCTCAGTCCCCGCCTCGCCGGGG - Intergenic
1108053806 13:46467267-46467289 TCTCAGTCCCCGCCTCGCAGGGG - Intergenic
1108053831 13:46467347-46467369 TCTCAGTCCCTGCCTCGTGGGGG - Intergenic
1108053862 13:46467427-46467449 TCTGCGTCCCTGCCTCGTGGGGG - Intergenic
1108053891 13:46467506-46467528 TCTCAGTCCCCGCCTCGTGGGGG - Intergenic
1108053916 13:46467586-46467608 TCTCAGTCCCTGCCTCGTTGGGG - Intergenic
1109537113 13:63737479-63737501 TCTCAGTTCCCGCCTCGCGGCGG + Intergenic
1109537145 13:63737563-63737585 TGTCAGTCCCCGCCTCCCGGGGG + Intergenic
1109537175 13:63737643-63737665 TTTCAGTACCCGCCTCGCGGGGG + Intergenic
1109537203 13:63737723-63737745 TCTCTGTCCCCTCGTCGCGGGGG + Intergenic
1109537481 13:63739082-63739104 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1109537536 13:63739244-63739266 TCTCAGTCCCCGCTTCGCGAGGG + Intergenic
1109537567 13:63739324-63739346 TCTCAATCCCCGCCTCGCGGGGG + Intergenic
1109537614 13:63739483-63739505 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1109537643 13:63739561-63739583 TCTCAGTCCCCGCCTCGCGGAGG + Intergenic
1109537923 13:63740974-63740996 TCTCAGTCCCTGTCTCACGGGGG + Intergenic
1109537951 13:63741052-63741074 TGTCAGTCCCTCCCTCGTGGGGG + Intergenic
1109538030 13:63741291-63741313 TCTGAGTTCCCGCCTCGCGGGGG + Intergenic
1109538058 13:63741370-63741392 TCTCACTCCTCGGCTCGCGGAGG + Intergenic
1109538080 13:63741449-63741471 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1109538104 13:63741529-63741551 ACTCAGTCCCGGCCTCGTGGGGG + Intergenic
1109538149 13:63741687-63741709 TCTGAGTCCCCGCCTCGCGGGGG + Intergenic
1109538203 13:63741845-63741867 TCTCAGTCCCTTCCTCGCGGGGG + Intergenic
1109538229 13:63741925-63741947 TCTCAGTCGCCGCCTCGCGGGGG + Intergenic
1109538279 13:63742082-63742104 TCTGAGTCCCTGCCTCTCGGGGG + Intergenic
1109538330 13:63742242-63742264 TCTCAGTCCCTGCCTCAGTGGGG + Intergenic
1109545509 13:63837530-63837552 TCTCAGTCCCTGCCTCAGTGGGG - Intergenic
1109545559 13:63837690-63837712 TCTGAGTCCCTGCCTCTCGGGGG - Intergenic
1109545608 13:63837847-63837869 TCTCAGTAGCCGCCTCGCGGGGG - Intergenic
1109545633 13:63837927-63837949 TCTCAGTCCCTTCCTCGCGGGGG - Intergenic
1109545870 13:63838914-63838936 TGTCAGTCCCTCCCCCGTGGGGG - Intergenic
1109545901 13:63838994-63839016 TCTCAGTCCCCGCCTCTCGGAGG - Intergenic
1109546180 13:63840408-63840430 TCTCAGTCCCCGCCTCGCGGAGG - Intergenic
1109546212 13:63840486-63840508 TCTCAGTCCCCGCCTCGTGGGGG - Intergenic
1109546261 13:63840643-63840665 TGTCAGTCCCCGCCTCGCGGGGG - Intergenic
1109546316 13:63840801-63840823 TCTCAGTTCCTGCCTGGCGGGGG - Intergenic
1109546363 13:63840959-63840981 TCTCAATCCTCGGCTCGCGGGGG - Intergenic
1109546392 13:63841039-63841061 TGTCAGTACCCGCCTCGCGGGGG - Intergenic
1109546420 13:63841116-63841138 TCTCAGTCCCCGCTTCGCGGGGG - Intergenic
1109546470 13:63841275-63841297 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1109546494 13:63841355-63841377 ACTCAGTCCCCGCCTCGTGGGGG - Intergenic
1109546665 13:63842178-63842200 TCTCAGTCCCCGCCTCGCGGAGG - Intergenic
1109546687 13:63842257-63842279 TCTCAGTCCTCGGCTCGCGGGGG - Intergenic
1109546714 13:63842336-63842358 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1109546736 13:63842414-63842436 TCTCAGTCCCCGCCTCGTGGGGG - Intergenic
1109547039 13:63843907-63843929 TCTCAGTCCCCGCCTCACAGAGG - Intergenic
1109547063 13:63843985-63844007 TCTCAGTCCCTGCCTCGCGGGGG - Intergenic
1109547090 13:63844064-63844086 TCTCTGTCCCCTCGTCGCGGGGG - Intergenic
1109547133 13:63844222-63844244 TCTTACTCCCTGCCTCGCGGGGG - Intergenic
1109547157 13:63844301-63844323 TCTCAGTCCTCGGCGCGCGGCGG - Intergenic
1109840840 13:67914850-67914872 TCTTACTCCCCGCATCGCGGGGG - Intergenic
1110410405 13:75198559-75198581 TCTCACTGCCTGCCTCTCGAGGG - Intergenic
1110891538 13:80704381-80704403 TCTCAATCCCTGCCTCGCGGGGG - Intergenic
1110891647 13:80704701-80704723 TCTCAGTTCCCGCCTCACAGGGG - Intergenic
1110891797 13:80705449-80705471 TCTCAGTCCCCGCCTCGTGGGGG - Intergenic
1110891893 13:80705763-80705785 TCTCCATCCCCGCCTCGCGAGGG - Intergenic
1110891917 13:80705843-80705865 TCTCAGTCCCTGCCTCGCAGTGG - Intergenic
1110891946 13:80705921-80705943 TCTGAGTCCCCGCCTCACGGGGG - Intergenic
1110891978 13:80706000-80706022 TCTTAGTCCCCACCTCGCTGGGG - Intergenic
1110892006 13:80706079-80706101 TCTCAGTCCCTACCTCATGGGGG - Intergenic
1110892019 13:80706118-80706140 TCTCAGTCCCCGCGTCGTGGGGG - Intergenic
1110892047 13:80706198-80706220 TCTCAGTCCCTGCCTCGCGGGGG - Intergenic
1110892072 13:80706277-80706299 GCTGAGTCCCTGCCTCGCGGGGG - Intergenic
1110892103 13:80706354-80706376 TCTCAGTCCCCACCTTGCGGGGG - Intergenic
1110892252 13:80707101-80707123 TCTCAGTCCCCGCCTCACGGAGG - Intergenic
1110892278 13:80707180-80707202 TCTCAGTCCCTGCCTCGCGGGGG - Intergenic
1110892305 13:80707260-80707282 TCTCAGTCCACACCTCACGGGGG - Intergenic
1110892358 13:80707421-80707443 TCTCAGTCCCCGCCTCGCAGGGG - Intergenic
1110892467 13:80707742-80707764 TCTCAGTCCCCGCCTCGGAGGGG - Intergenic
1110892495 13:80707821-80707843 TCTCAGTACCCGCCTCGCGGGGG - Intergenic
1112159183 13:96850544-96850566 TCTCTGTGCCTCCCTCGGGGAGG + Intergenic
1113370644 13:109722199-109722221 TCTCAGTCGCTGACTGGAGGGGG - Intergenic
1117037736 14:51744802-51744824 TCTTACTCCCCGCATCGCGGGGG - Intergenic
1120632283 14:86905560-86905582 TCCCAAGCCCTGCCCCGCGGGGG + Intergenic
1122293486 14:100692327-100692349 CCTCAGTCCCTGCCCGGCGCCGG + Intergenic
1128559496 15:68655369-68655391 TCACAGTCCATGCCTCTCGCCGG + Intronic
1128718065 15:69924157-69924179 CCTCAGTCCTTGCCTCTAGGTGG + Intergenic
1133057038 16:3150481-3150503 TCACAGTCCCGGGCCCGCGGCGG + Intergenic
1133273815 16:4624972-4624994 TCTCAGCCGCCGCATCGCGGGGG + Exonic
1133285072 16:4686902-4686924 GCTCAGTCCCTGTCTCTTGGAGG + Intronic
1134228205 16:12408497-12408519 TCCCAGAACCTGCCTCGGGGTGG + Intronic
1136050797 16:27648531-27648553 TGCCAGTCCCTGCCCCGCAGAGG + Intronic
1137456306 16:48620674-48620696 GCTCAGTCCCTTCCTAGTGGTGG - Intergenic
1137626163 16:49910136-49910158 TCACAGCCCCTGCTTCTCGGTGG - Intergenic
1141070328 16:80948690-80948712 CCTCAGCCTCTGCCTCGGGGTGG + Intergenic
1141645290 16:85364239-85364261 TCTCAGACCCTGCTTCCGGGTGG + Intergenic
1141995520 16:87634514-87634536 TCTGCGTCCCTGCCTCCAGGTGG + Intronic
1142559659 17:802659-802681 TCACAGGCCCTGCCTCGGGGTGG - Intronic
1142610029 17:1104009-1104031 TCCCAGTGCCTGGCTCCCGGTGG - Intronic
1143107373 17:4536458-4536480 TCACGGTCCCTGCTTCCCGGCGG - Intronic
1148745772 17:49917214-49917236 ACTCAGTCACTGCCTTGCTGAGG - Intergenic
1157167163 18:45368439-45368461 TCTCAGTCTCTGACTCCTGGTGG - Intronic
1160146699 18:76371370-76371392 TCTCAGTATCTCCCTCGCTGCGG + Intronic
1162754957 19:12852311-12852333 TCTCAGTCCCTCCCTAGATGTGG + Exonic
1164402444 19:27911282-27911304 GCACAGTCCCTGGCTCCCGGCGG - Intergenic
1165118703 19:33545371-33545393 TCTCAGTACCTGCTTCCTGGGGG - Intergenic
926243908 2:11107981-11108003 TCCAAGTCCCTGCCTCGTGCAGG - Intergenic
927488449 2:23504938-23504960 GCTCAGTGCCTGCCCCGTGGAGG - Intronic
928392099 2:30918043-30918065 CCTCAGTCCCTCCCTGGTGGAGG + Intronic
933457237 2:82531065-82531087 TCTTAGTCCCCGCATCGCGGGGG + Intergenic
933744673 2:85561784-85561806 TCTCCGTCCCTGCGTCCCTGCGG + Intronic
935618884 2:105111916-105111938 TCACAGCCCCTGCCCCGCCGAGG - Intergenic
936151051 2:110022689-110022711 TCTCAGTCCCTGCCTCGGCTGGG - Intergenic
936193626 2:110348680-110348702 TCTCAGTCCCTGCCTCGGCTGGG + Intergenic
937059392 2:118970441-118970463 TCTAAGTCCCTGGCTCTTGGAGG - Intronic
937289800 2:120775517-120775539 CCCCAGTGCCTGCCTCGGGGTGG + Intronic
937799725 2:126069159-126069181 CCTCAGTTCCAGCCTCGCTGGGG + Intergenic
938243561 2:129760969-129760991 TCTCAGTCCCTGCCCTGCTGTGG - Intergenic
939992897 2:148892322-148892344 TCTCATTCTCTGCCTCTTGGAGG + Intronic
946606442 2:221410585-221410607 CCTGAGTCAGTGCCTCGCGGAGG - Intergenic
947735081 2:232450104-232450126 TCCCACTTCCTGCCTCGTGGCGG - Intergenic
1168773966 20:433313-433335 TCTAAGTCACTGCCTCTCGGAGG - Intergenic
1170822663 20:19767504-19767526 TCTCAGTCCCATCCTCCCTGAGG - Intergenic
1173717154 20:45218528-45218550 TCTCATTCCCTTCCTCTCGTAGG - Intergenic
1174418006 20:50380257-50380279 TCTCAGTCTCAGCCACGCGCAGG + Intergenic
1177147383 21:17421158-17421180 ACTCAGTCTCTACCTCGAGGTGG + Intergenic
1180414176 22:12693655-12693677 CATCAGCCCCTGCCACGCGGAGG + Intergenic
1183116618 22:35697347-35697369 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1184572559 22:45335268-45335290 TCCCAGTCACTGCCTCAGGGTGG + Intronic
1185059651 22:48599649-48599671 TCACAGGCCCTGCCTCCTGGAGG + Intronic
949883108 3:8676798-8676820 TCTCAGTCCCCGCCTCACTGGGG - Intronic
949883136 3:8676877-8676899 TCTCTGTCCCCGCCTCACGGGGG - Intronic
949883166 3:8676958-8676980 TCTCAGTCCCCGCCTCACAGGGG - Intronic
949883193 3:8677038-8677060 TCGCAGTCCCCGCCTCCTGGGGG - Intronic
949883218 3:8677118-8677140 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
949883468 3:8678502-8678524 TCTCAGTCCCCGCCTCGCGGGGG - Intronic
949883493 3:8678581-8678603 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
949883524 3:8678660-8678682 TCTCAATCCCCGCCTCGCGGGGG - Intronic
949883603 3:8678904-8678926 TCTCAGTCCCCGCCTGGCGGGGG - Intronic
949883627 3:8678984-8679006 TCTCAGTCCCCACCTCGCGGGGG - Intronic
949883653 3:8679063-8679085 TCTCAGTCCCCGCCTCGCGGGGG - Intronic
949883678 3:8679140-8679162 TCTCAGTCCCCGCCTCGCGGGGG - Intronic
949883732 3:8679297-8679319 TCTTAGTCCCCGCCTCATGGGGG - Intronic
949883759 3:8679378-8679400 TCTCAGTCCCCTCCTCCTGGGGG - Intronic
949883792 3:8679458-8679480 TCTCAGTCCCCGCCTCCCGGGGG - Intronic
949883819 3:8679537-8679559 TCTCAGTTCCTGCCTCGCTGAGG - Intronic
949883847 3:8679617-8679639 TCTCATTCCCCGCCTCACCGGGG - Intronic
949884093 3:8681017-8681039 TCTCAGTCCCCGCCACTTGGAGG - Intronic
949884116 3:8681096-8681118 TCTCAGAACCCGCCTCGCGGGGG - Intronic
949884197 3:8681332-8681354 TCTCAGTCCCCGAGCCGCGGGGG - Intronic
949884221 3:8681411-8681433 TCTCAGTCCCGGGCTCGCCGGGG - Intronic
949884250 3:8681489-8681511 TCTCAGTCCCCGCCTCGTGGGGG - Intronic
949884279 3:8681566-8681588 TCTCAGTCCCCGCTTCGTTGGGG - Intronic
949884334 3:8681723-8681745 TCTCACTCCCCGCCTCCCAGGGG - Intronic
949884360 3:8681803-8681825 TCTCAGTCCCCACCCTGCGGTGG - Intronic
954444818 3:50540917-50540939 TCTCAGCCCCTGCGTCAGGGAGG - Intergenic
957077298 3:75612076-75612098 TTTCACTCCCTGCATCGCGGGGG + Intergenic
957077329 3:75612159-75612181 TCTCACTCCCCGCATCGCGGGGG + Intergenic
958662491 3:97088692-97088714 TCTCAGTGCCTGCCTGGGAGAGG + Intronic
961274462 3:125715995-125716017 TCTGACTCCCTGCATAGCGGGGG - Intergenic
961277400 3:125738628-125738650 TCTTACTCCCCGCATCGCGGGGG - Intergenic
961877026 3:130031040-130031062 TCTTACTCCCCGCATCGCGGGGG + Intergenic
968989304 4:3898230-3898252 TCTTACTCCCCGCATCGCGGGGG + Intergenic
969025868 4:4171808-4171830 TCTTACTCCTTGCATCGCGGGGG + Intergenic
969137722 4:5044133-5044155 TCTCAATCCCTGCCTCTGCGAGG + Intergenic
969730877 4:8956917-8956939 TCTTACTCCCCGCATCGCGGGGG - Intergenic
969730909 4:8956998-8957020 TCTTACTCCCCGCATCGCGGGGG - Intergenic
969785031 4:9450826-9450848 TCTTACTCCCCGCATCGCGGGGG - Intergenic
969787782 4:9473212-9473234 TATTACTCCCTGCATCGCGGGGG - Intergenic
969790497 4:9491103-9491125 TCTTACTCCCCGCATCGCGGGGG - Intergenic
969790524 4:9491186-9491208 TCTTACTCCCCGCATCGCGGGGG - Intergenic
969790839 4:9493339-9493361 TCTTACTCCCCGCATCGCGGGGG - Intergenic
969792742 4:9503260-9503282 TCTTACTCCCCGCATCGCGGGGG - Intergenic
969826007 4:9758881-9758903 TCTTACTCCCCGCGTCGCGGGGG - Intergenic
981044755 4:140254408-140254430 GCTCAGTCCCTGCATCCCAGGGG - Intergenic
981940971 4:150281308-150281330 TCTCTGTGCGTGCCTCGTGGAGG + Intronic
982985791 4:162203819-162203841 TCCCAAGCCCTGCCCCGCGGCGG - Intergenic
985129443 4:186725575-186725597 TCTCCATCCCTGGCTCTCGGCGG - Intronic
986730406 5:10631176-10631198 TCTCAGTCCCTTCTTCCCTGAGG - Intronic
987122432 5:14779511-14779533 GCCCAGTCCCTGCCTCAAGGAGG - Intronic
987262282 5:16215735-16215757 TCTCAGTCCCAGCCACTCTGGGG + Intergenic
992409237 5:76489117-76489139 TCTCCCTCCGTGCCTCGCAGTGG + Intronic
994670254 5:102755124-102755146 TCTCAGTCCCTCCCCGGGGGCGG - Intronic
994771961 5:103993154-103993176 TCTCACTTCCTGCCTCCAGGAGG - Intergenic
996715894 5:126587827-126587849 TCTAAGTCCCTGCCCCAGGGAGG + Intronic
998783987 5:145689270-145689292 TCTAAGGACCTGCCTCACGGAGG - Intronic
999769615 5:154765402-154765424 ACTCAGACCCTGCCTTGGGGCGG - Intronic
1002562533 5:180092067-180092089 TCTCAGTCACTGCTTCACTGTGG + Intergenic
1006199136 6:32270721-32270743 TCTCACTCCCCGCATCGCGGGGG - Intergenic
1007593457 6:43037420-43037442 TCTCAATCTCTGCCTAGAGGGGG + Intergenic
1017124383 6:151051888-151051910 CCTCAGTCCCTGCCTCCCTCAGG - Intronic
1017170787 6:151452461-151452483 TCTCAGCTCCTCCTTCGCGGCGG + Exonic
1017856400 6:158353178-158353200 TCCCAGTCCCTGCCTCTATGTGG + Intronic
1018240530 6:161769966-161769988 TCTCAGTCCCTGGCTCTCCCAGG - Intronic
1018765494 6:166929642-166929664 TCTCAGACCCCGGCTCTCGGCGG + Exonic
1019577867 7:1746193-1746215 TCACAGTCCCTGCGTTCCGGAGG - Exonic
1026516594 7:71078219-71078241 TCCCGATCCCTGCCCCGCGGAGG - Intergenic
1026848430 7:73710362-73710384 CCTCAGTCCCTGCCCCAGGGTGG - Intronic
1031398419 7:121302019-121302041 GCTCTGTCACTGCCTGGCGGAGG - Intergenic
1033361694 7:140642499-140642521 TCTCAGTCTCTCACCCGCGGTGG + Intronic
1034303176 7:150033656-150033678 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034303229 7:150033817-150033839 TCTCAGTCCCTGCCTCGTGGGGG + Intergenic
1034303253 7:150033897-150033919 TCTCAGTCCCCGCGTCGCGAGGG + Intergenic
1034303312 7:150034053-150034075 TCTGAGTCCCCGCCTCGCGGGGG + Intergenic
1034303461 7:150034796-150034818 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1034303488 7:150034876-150034898 TCTCAGTCCCTACCTCGCGGGGG + Intergenic
1034303576 7:150035184-150035206 TCTCAGTCCCCGCCTCACGGGGG + Intergenic
1034303658 7:150035427-150035449 TCTCAGTCCCTGACTCGCGGGGG + Intergenic
1034303738 7:150035732-150035754 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1034303765 7:150035813-150035835 TCTCAGTCCCTGCCTTGCGGGGG + Intergenic
1034303819 7:150035975-150035997 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034303841 7:150036054-150036076 TCTCAGTCCCCGCGTCGCGAGGG + Intergenic
1034303871 7:150036133-150036155 TCTGAGTCCCCGCCTCGTGGGGG + Intergenic
1034304053 7:150036965-150036987 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034304111 7:150037127-150037149 TCTCAGTCCCTGCCTCGTGGGGG + Intergenic
1034304170 7:150037353-150037375 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1034304197 7:150037434-150037456 TCTCAATCCCTGCCTCGCGGGGG + Intergenic
1034304317 7:150037822-150037844 ACTCAGTCCCTGCCTCGCGGAGG + Intergenic
1034304342 7:150037902-150037924 TCTCAGTCCCCGCGTCGCGAGGG + Intergenic
1034304396 7:150038059-150038081 TCTGAGTCCCCACCTCGCGGGGG + Intergenic
1034304542 7:150038781-150038803 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1034304572 7:150038862-150038884 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034304656 7:150039171-150039193 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1034304686 7:150039252-150039274 TCTCAATCTCTGCCTCGGGGGGG + Intergenic
1034304741 7:150039412-150039434 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034304864 7:150039798-150039820 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034304938 7:150040035-150040057 TCTGAGTCCCCGCCTCGCGGGGG + Intergenic
1034305087 7:150040781-150040803 TCTCAGTCCCCGCCTTGCGGGGG + Intergenic
1034305232 7:150041528-150041550 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1034305262 7:150041609-150041631 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034305322 7:150041772-150041794 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034305407 7:150042079-150042101 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034305436 7:150042160-150042182 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034305495 7:150042322-150042344 TCTCAGTCCCTGCCTCGCGGGGG + Intergenic
1034305520 7:150042402-150042424 TCTCAGTCCCCGCGTCGCGAGGG + Intergenic
1034305571 7:150042559-150042581 TCTGAGTCCCCGCCTCGCGGGGG + Intergenic
1034305719 7:150043305-150043327 TCTCAGTCCCCGCCTTGCGGGGG + Intergenic
1034801124 7:154057345-154057367 TCTCAGTCCCCGCCTCGCGGGGG - Intronic
1034801273 7:154058093-154058115 TCTGAGTCCCCGCCTCATGGGGG - Intronic
1034801332 7:154058251-154058273 TCTCAGTCCCCGCATCACGAGGG - Intronic
1034801356 7:154058331-154058353 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
1034801411 7:154058492-154058514 TCTCAGTCCCTGCCTCGCGGAGG - Intronic
1034801438 7:154058573-154058595 TCTCAGTCCCCGCCTCGCGGGGG - Intronic
1034801550 7:154058961-154058983 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
1034801578 7:154059041-154059063 TCTCAGTCCCCGCCTCGTGGGGG - Intronic
1034801631 7:154059203-154059225 TCTCAGTCCCTACCTCGCGGGGG - Intronic
1034801658 7:154059283-154059305 TCTCAGTCCCCGCCTCAAGGGGG - Intronic
1034801808 7:154060025-154060047 TCTGAGTCCCCGCCTCGCGGGGG - Intronic
1034801887 7:154060261-154060283 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
1034801916 7:154060341-154060363 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
1034801946 7:154060422-154060444 TCGCAGTCCCCGCCTCGCGGGGG - Intronic
1034802030 7:154060729-154060751 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
1034802056 7:154060809-154060831 TCTCAGTCCCTGCCTCATGGGGG - Intronic
1034802081 7:154060889-154060911 TCTCAGTCCCCGCCTCGTGGGGG - Intronic
1034802231 7:154061632-154061654 TCTGAGTCCCCGCCTCGCAGCGG - Intronic
1034802284 7:154061789-154061811 TCTCAGTCCCCGCGTCGCGAGGG - Intronic
1034802308 7:154061869-154061891 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
1034802366 7:154062030-154062052 TGTCAGTCCCTGCCTCGCGGGGG - Intronic
1034802395 7:154062111-154062133 TCTCAGTCCCCGCCTCGCGGGGG - Intronic
1034802484 7:154062417-154062439 TCTCAGTCCCTGCCTAGCGGAGG - Intronic
1034802542 7:154062579-154062601 TCTCAGTCCCTGCCTAGCGGAGG - Intronic
1034802597 7:154062742-154062764 TCTCAGTCCCTGCCTCGCGGAGG - Intronic
1034802625 7:154062823-154062845 TCGCAGTCCCCGCCTCGCGGGGG - Intronic
1034802737 7:154063212-154063234 TCTCAGTCCCTGCCTCGCGGGGG - Intronic
1034802767 7:154063292-154063314 TCTCAGTCCCCGCCTCATGGGGG - Intronic
1034802868 7:154063613-154063635 TCTCAGTCCCTGCCTCGTGGGGG - Intronic
1036213735 8:6863067-6863089 ACTCAGTACCTGCTTTGCGGTGG + Intergenic
1036818150 8:11917087-11917109 TATTACTCCCTGCATCGCGGGGG + Intergenic
1036833960 8:12043089-12043111 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1036855806 8:12289654-12289676 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1037430967 8:18812798-18812820 TCTCAGTCGCTGGCCTGCGGTGG + Intronic
1039620814 8:38996096-38996118 TTTCAGACCCTGCCTCTCTGAGG - Intronic
1042022394 8:64381328-64381350 TCTCACCCCCTGCCTCAGGGCGG + Intergenic
1047013067 8:120693153-120693175 ACTCACTCACTGCCTCGGGGCGG + Intronic
1049399736 8:142419615-142419637 TCTGAGTCTCTGTCTTGCGGAGG + Intergenic
1053736144 9:41104221-41104243 TGTCAGTCCCCTCCTCGCGGGGG - Intergenic
1053736202 9:41104602-41104624 TCTCAGTCACCGCCTCGCGGGGG - Intergenic
1053736229 9:41104682-41104704 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1053736255 9:41104762-41104784 TCTGAGACCCCGCCTCGCGGGGG - Intergenic
1053736282 9:41104841-41104863 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1053736544 9:41106614-41106636 GCTCAGTCCCCGCCTTGCGGGGG - Intergenic
1053736621 9:41106852-41106874 TCTCAGTCCCCGCCTCGCGAGGG - Intergenic
1053736643 9:41106931-41106953 TCTGAGTCCTTGCCTCGCGGGGG - Intergenic
1053736690 9:41107088-41107110 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1053736729 9:41107193-41107215 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1053736758 9:41107269-41107291 TGTCAGTCCCCGCCACGCGGGGG - Intergenic
1053736784 9:41107348-41107370 TCTCAGTCCCCGCCTCACGGGGG - Intergenic
1053736810 9:41107428-41107450 TCTTAGACACCGCCTCGCGGGGG - Intergenic
1053736980 9:41108255-41108277 TCTCTGTCCCCGCCTCGCCGGGG - Intergenic
1053737032 9:41108415-41108437 TCTCAGTCCCCACCTCGCGAGGG - Intergenic
1053737056 9:41108495-41108517 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1053737084 9:41108575-41108597 TCTCAGTCCACGCCTCGTGGGGG - Intergenic
1053737114 9:41108654-41108676 TCTCAGTCCCCTCCTCCCGGGGG - Intergenic
1053737203 9:41108896-41108918 TCGCAGTCCCTGTCTCGCGGGGG - Intergenic
1053737230 9:41108975-41108997 TCTCAGTCCCCGCCTCGCGGGGG - Intergenic
1054691119 9:68322344-68322366 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1054691146 9:68322423-68322445 TCGCAGTCCCTGTCTCGCGGGGG + Intergenic
1054691234 9:68322663-68322685 TCTCAGTCCCCTCCTCCCGGGGG + Intergenic
1054691264 9:68322742-68322764 TCTCAGTCCACGCCTCGTGGGGG + Intergenic
1054691292 9:68322822-68322844 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1054691316 9:68322902-68322924 TCTCAGTCCCCACCTCGCGAGGG + Intergenic
1054691342 9:68322982-68323004 TGTCAGTCCCCACCTCGCGAGGG + Intergenic
1054691394 9:68323142-68323164 TCTCTGTCCCCGCCTCGCCGGGG + Intergenic
1054691563 9:68323969-68323991 TCTTAGACACCGCCTCGCGGGGG + Intergenic
1054691589 9:68324049-68324071 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1054691615 9:68324128-68324150 TGTCAGTCCCCGCCACGCGGGGG + Intergenic
1054691644 9:68324207-68324229 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1054691681 9:68324312-68324334 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1054691729 9:68324470-68324492 TCTGAGTCCTTGCCTCGCGGGGG + Intergenic
1054691750 9:68324548-68324570 TCTCAGTCCCCGCCTCGCGAGGG + Intergenic
1054691827 9:68324786-68324808 GCTCAGTCCCCGCCTTGCGGGGG + Intergenic
1054692091 9:68326559-68326581 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1054692118 9:68326638-68326660 TCTGAGACCCCGCCTCGCGGGGG + Intergenic
1054692145 9:68326718-68326740 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1054692172 9:68326798-68326820 TCTCAGTCACCGCCTCGCGGGGG + Intergenic
1054692230 9:68327179-68327201 TGTCAGTCCCCTCCTCGCGGGGG + Intergenic
1055121234 9:72663215-72663237 TCTTAGTTCCTGCTTAGCGGAGG + Intronic
1056517682 9:87370890-87370912 AGTCAGTCCCTGCCTCAGGGAGG + Intergenic
1056864796 9:90219884-90219906 TCTCAGTCCCCGCATCGCGGGGG - Intergenic
1056918231 9:90763002-90763024 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1056918259 9:90763081-90763103 TCTTACTCCCCGCATCGCGGGGG + Intergenic
1057232586 9:93333218-93333240 TCTCAATCCCTCCCTGCCGGAGG + Intronic
1059525774 9:114989726-114989748 CCTCAGTCTCTGCCTCTCAGTGG + Intergenic
1060027527 9:120185533-120185555 TCTCAGTGTCTGCCTCCTGGGGG + Intergenic
1061040431 9:128138441-128138463 TCTCAGTCCCCGCCTCTCGGGGG + Intergenic
1061040487 9:128138601-128138623 TCTCAGGCACCGCCTCGCGGGGG + Intergenic
1061040515 9:128138679-128138701 TCTCAGTCTCCGCCTCGCGGGGG + Intergenic
1061040543 9:128138759-128138781 TGTCAGTCCCCGCCTCGCGGGGG + Intergenic
1061040569 9:128138838-128138860 TCTCAGTCCCCGCCTCGTGGGGG + Intergenic
1061040600 9:128138919-128138941 TCTCAGTCCCCGCCTCGCGGGGG + Intergenic
1061040628 9:128138998-128139020 TCTCAGTCCCCGCCATGCTGGGG + Intergenic
1061040706 9:128139236-128139258 TCTGAGTCCCCGCCTCGCGGGGG + Intergenic
1061040731 9:128139316-128139338 TCACAGTCCCCGCCTCGCCGTGG + Intergenic
1061040762 9:128139395-128139417 TGTCAGTTCCCGCCTAGCGGGGG + Intergenic
1061040811 9:128139555-128139577 TCTCAGTCCCCGCCTCACGGGGG + Intergenic
1061040839 9:128139637-128139659 TGTCAGTCCCCGCCTCGCGGGGG + Intergenic
1061040867 9:128139717-128139739 TCCCAGTCCCCAACTCGCGGGGG + Intergenic
1061040892 9:128139796-128139818 TCTCAGTCCCTGCGTCGCGGTGG + Intergenic
1062050203 9:134443200-134443222 TCTGAGTCCCTGCCAGGGGGCGG - Intergenic
1062056678 9:134472599-134472621 TCTCAGTGCCTGCCTTGGTGGGG + Intergenic
1062082820 9:134633466-134633488 CCACAGTGCCTACCTCGCGGGGG + Intergenic
1062100305 9:134724535-134724557 TCTCAGTGCCTGTCTTGCTGTGG + Intronic
1062325908 9:136012391-136012413 TCCCAGTCCCAGCCTGGAGGAGG + Intronic
1187135767 X:16545927-16545949 TCTCAGTGCCTGCTTCTTGGGGG - Intergenic
1195960022 X:110376779-110376801 TCACAGTACCTGCCTTGCAGAGG + Intronic
1199978615 X:152908745-152908767 TCTGAGTCCCAGCCACGCAGTGG - Intergenic