ID: 1109538081

View in Genome Browser
Species Human (GRCh38)
Location 13:63741450-63741472
Sequence CTCAGTCCCTGCCTCGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 26, 1: 76, 2: 99, 3: 106, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109538076_1109538081 0 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538081 13:63741450-63741472 CTCAGTCCCTGCCTCGCGGGGGG 0: 26
1: 76
2: 99
3: 106
4: 247
1109538067_1109538081 26 Left 1109538067 13:63741401-63741423 CCTCACTGAGATGGGGGTCCTAA No data
Right 1109538081 13:63741450-63741472 CTCAGTCCCTGCCTCGCGGGGGG 0: 26
1: 76
2: 99
3: 106
4: 247
1109538071_1109538081 8 Left 1109538071 13:63741419-63741441 CCTAAGAGCCAGTGGGGAAGAGG No data
Right 1109538081 13:63741450-63741472 CTCAGTCCCTGCCTCGCGGGGGG 0: 26
1: 76
2: 99
3: 106
4: 247
1109538065_1109538081 28 Left 1109538065 13:63741399-63741421 CCCCTCACTGAGATGGGGGTCCT No data
Right 1109538081 13:63741450-63741472 CTCAGTCCCTGCCTCGCGGGGGG 0: 26
1: 76
2: 99
3: 106
4: 247
1109538066_1109538081 27 Left 1109538066 13:63741400-63741422 CCCTCACTGAGATGGGGGTCCTA No data
Right 1109538081 13:63741450-63741472 CTCAGTCCCTGCCTCGCGGGGGG 0: 26
1: 76
2: 99
3: 106
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109538081 Original CRISPR CTCAGTCCCTGCCTCGCGGG GGG Intergenic
900094670 1:935445-935467 CTCACTCCCTGCCTCAAAGGGGG - Intronic
900265195 1:1753749-1753771 CTCTGACCCTGCCTTGCGGACGG + Intronic
900532255 1:3160364-3160386 CTCAGTCCCTGGCTGGGGGAGGG + Intronic
902233287 1:15041927-15041949 CATAGTCCCTGCCTCAGGGGTGG + Intronic
902234788 1:15050478-15050500 CACAGTCCCTGCCTCTCGTCTGG - Intronic
903358817 1:22764352-22764374 ATTAGTACCTGCCTCGCAGGTGG - Intronic
906627134 1:47334244-47334266 CTCGGCCACTGCCACGCGGGCGG - Intronic
907524822 1:55047984-55048006 CTCAGTCCCTGCCTGGACTGGGG - Intronic
907549471 1:55292209-55292231 CACAGGCCCAGCCTCGGGGGAGG - Intergenic
907767185 1:57423492-57423514 CTCCCTCCCTCCCTCGCTGGTGG - Intronic
915264821 1:154709289-154709311 CTCACTCCCTGACACGTGGGAGG - Intronic
915571854 1:156749192-156749214 CTCAGTCCCTGCTGCTGGGGAGG - Intronic
915936399 1:160092516-160092538 CTCTGTCCCTGCCCAGCTGGTGG - Exonic
916162898 1:161937220-161937242 GTCAGTCCCTGCTACTCGGGAGG + Intronic
920250269 1:204618417-204618439 CTTCGTCCCTGCCTGGCTGGAGG + Exonic
924425058 1:243943128-243943150 CTGAGCCCCAGCCTCCCGGGTGG + Intergenic
1064261555 10:13790521-13790543 CTCTGTCCCTGGCTCGGGGCAGG - Intronic
1065997013 10:31068911-31068933 CTCTGTCCCTGCCTGAGGGGAGG - Intergenic
1068954385 10:62808787-62808809 CTCAGTCCTGGCATCTCGGGAGG + Intergenic
1069425089 10:68281485-68281507 CCCAGTCCCTGCTTCTCTGGTGG + Intergenic
1072625670 10:97109807-97109829 CTCAGTCCCTGCCAAGCTGCTGG + Intronic
1074973924 10:118565563-118565585 CTCAGGCCCTGGCTCTGGGGGGG - Intergenic
1075898842 10:126021721-126021743 CATAGTCCCTTCCTCCCGGGTGG + Intronic
1076479848 10:130777862-130777884 CTGTGTCCCTGCCTTTCGGGAGG - Intergenic
1076538934 10:131201306-131201328 CGCTGTCCCTGCCTTGTGGGTGG - Intronic
1076603025 10:131671215-131671237 CTCAGTCCCTGCCTTGGGCTGGG + Intergenic
1076686080 10:132199053-132199075 CTGAGTCCCTGCATCGGGGCGGG + Intronic
1076686091 10:132199086-132199108 CTGAGTCCCTGCATCGGGGTGGG + Intronic
1076686101 10:132199119-132199141 CTGAGTCCCTGCATCGGGGCAGG + Intronic
1076874935 10:133211249-133211271 CTCAGCTCCTGCCTCGGGGGAGG + Intronic
1077576387 11:3387008-3387030 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1077576417 11:3387089-3387111 CTTACTCCCTGCATCGCGGGGGG + Intergenic
1077576510 11:3387476-3387498 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1079980263 11:27143723-27143745 TTCAGTCCCTGCCTGGTGGAAGG - Intergenic
1081868639 11:46373052-46373074 CTCAGGCCCTGCCTCGGGGTTGG - Exonic
1082814627 11:57499810-57499832 CTCAGACCCTCCCTGGCGGCCGG - Intronic
1083853683 11:65381799-65381821 CTGAGTTCCGGCCTGGCGGGAGG - Intronic
1084228383 11:67732026-67732048 ATTAGTCCCCGCATCGCGGGGGG + Intergenic
1084228406 11:67732104-67732126 ATTAGTCCCCGCATCGCGGGGGG + Intergenic
1084228427 11:67732182-67732204 ATTAGTCCCAGCATCGCGGGGGG + Intergenic
1084264098 11:67996099-67996121 CTTACTCCCCGCATCGCGGGGGG + Intronic
1084806751 11:71584546-71584568 CTTACTCCCCGCATCGCGGGGGG - Intronic
1084808959 11:71600712-71600734 CTTACTCCCCGCATCGCGGGGGG - Intronic
1084809244 11:71602785-71602807 CTTACTCCCCGCATCGCGGGAGG - Intronic
1084843968 11:71884952-71884974 CTTACTCCCTGCATCGTGGGGGG - Intronic
1084846806 11:71907353-71907375 CTTACTCCCCGCATCGCGGGGGG - Intronic
1086845689 11:91747251-91747273 CTCAGTCCTGGCCTCTCTGGTGG + Intergenic
1088882047 11:113980081-113980103 CTCTGTCCCTGCCTCGCAGAGGG + Intronic
1091718224 12:2794911-2794933 CCCAGCCCCTCCCTCGCGGCGGG + Intergenic
1092099758 12:5873479-5873501 ACCCGTCCCTGCCTCGCTGGAGG + Intronic
1092436275 12:8449207-8449229 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1092537303 12:9402643-9402665 CTCAGTCTCCGCCTCGCGGTGGG - Intergenic
1092537331 12:9402721-9402743 CTCAGTCCCCGCCTCGCGGGAGG - Intergenic
1092537358 12:9402801-9402823 CTCAGTCCCCGCCTCGCTTGGGG - Intergenic
1092537405 12:9402959-9402981 CTCAGTCCCCGCCTCGCTGCGGG - Intergenic
1092537453 12:9403118-9403140 GTCAGTCCCTGCCTCGCTGGGGG - Intergenic
1092537505 12:9403278-9403300 CTCAGTCCCCGCCTCGCTGGGGG - Intergenic
1092537531 12:9403360-9403382 CTCAGTCCCCGCCTCACAGGGGG - Intergenic
1092537555 12:9403438-9403460 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1092537587 12:9403519-9403541 CTCAGTCCCCACCTCGCGGGGGG - Intergenic
1092537750 12:9403941-9403963 CTCAGTCCCCGCCTCGCATGGGG - Intergenic
1092537774 12:9404021-9404043 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1092537822 12:9404177-9404199 CTCAGTCCCCGCCTCATGTGGGG - Intergenic
1092537860 12:9404282-9404304 CTCCGTCCCTGCCTCGCGGGGGG - Intergenic
1092537883 12:9404360-9404382 CTCAGTACCCGCCTCGCGTGGGG - Intergenic
1092537905 12:9404441-9404463 CTCAGTCCCCGCCTTGCATGGGG - Intergenic
1092537929 12:9404518-9404540 CTCAATCCCCGCCTCGCATGGGG - Intergenic
1092537993 12:9404708-9404730 GTCAGTCCCCGCCTCGCTGGGGG - Intergenic
1092538016 12:9404788-9404810 CTCAGAACCTGGCTCGCGGGGGG - Intergenic
1092538038 12:9404867-9404889 CTCAGTCTCTGCCTCGCGGGGGG - Intergenic
1092538067 12:9404946-9404968 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1092538098 12:9405024-9405046 CTCAGTCCCCGCCCCGTGGGGGG - Intergenic
1092538148 12:9405182-9405204 CTCAGTCCCAGCCTTGTAGGGGG - Intergenic
1092538442 12:9405900-9405922 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1092538474 12:9405982-9406004 CTCAGTCCCCGCCCCGTGGGGGG - Intergenic
1092538526 12:9406141-9406163 CTCAGTCCCAGCCTCGTAGGGGG - Intergenic
1092538616 12:9406506-9406528 CTCAGTCCCTGCCTCGCGGGGGG - Intergenic
1092538646 12:9406586-9406608 CTCAGTCCCCGCCTCGTGTGGGG - Intergenic
1092538671 12:9406666-9406688 CTCCGTCCCTGCCTCGCGGGGGG - Intergenic
1092538695 12:9406744-9406766 CTCAGTACCTGCCTCGCGTGGGG - Intergenic
1092538716 12:9406822-9406844 CTCAGTCCCTGCCTCACGGGGGG - Intergenic
1092538740 12:9406901-9406923 CTCAGTCCCCGCCTCGCATGGGG - Intergenic
1092538798 12:9407060-9407082 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1092538821 12:9407140-9407162 CTCAGTCTCTGCCTCGCGGGGGG - Intergenic
1092538848 12:9407220-9407242 CTCAGTCCGTGCCTCACGGGGGG - Intergenic
1092539099 12:9408632-9408654 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1092556579 12:9567699-9567721 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1092556636 12:9567858-9567880 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1092556889 12:9569268-9569290 CTCAGTCCCCGCCTCACGGGTGG + Intergenic
1092556937 12:9569424-9569446 CTCAGTCCCCGCCTCGCAGGCGG + Intergenic
1092556990 12:9569584-9569606 CTCAGTCCGCGCCTCACGGGGGG + Intergenic
1092557016 12:9569664-9569686 CTCAGTCTCTGCCTCGCGGGGGG + Intergenic
1092557037 12:9569744-9569766 CTCAGTCCCCGCCTCGCATGGGG + Intergenic
1092557075 12:9569865-9569887 CTCAGTCCCCGCATCGCGTGGGG + Intergenic
1092557103 12:9569944-9569966 GTCAGTCCCCGCCTCGCGGAGGG + Intergenic
1092557195 12:9570205-9570227 CTCAGTCCCCACCTCGCGGGGGG + Intergenic
1092557292 12:9570415-9570437 TTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1092557321 12:9570497-9570519 CTCAGTCCCCGCCTCGCTGGGGG + Intergenic
1092557348 12:9570577-9570599 CTCAGTCCCCGCCTCGCGGGAGG + Intergenic
1092557376 12:9570655-9570677 CTCAGTCTCCGCCTCGCGGTGGG + Intergenic
1093232403 12:16563051-16563073 CACTTTCCCTGCCTCGCTGGAGG + Intronic
1093548002 12:20369842-20369864 CTCACTCCCCGCCGCGGGGGTGG + Exonic
1094513902 12:31117254-31117276 CTCAGTCTCCCCCTCGCGGTGGG - Intergenic
1094513997 12:31117619-31117641 CTCAGTTCCCGCCTCACGAGGGG - Intergenic
1094514049 12:31117777-31117799 CTCAGTCCCCGCCTCGCTGCGGG - Intergenic
1094514073 12:31117857-31117879 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1094514177 12:31118173-31118195 CTCAGTCCCCGCCTCGCAGGGGG - Intergenic
1094514259 12:31118409-31118431 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1094514301 12:31118566-31118588 CTCAGTCCCCGTCTCTCGGGTGG - Intergenic
1094514333 12:31118646-31118668 CTCGATCCCCGCCTCTCGGGGGG - Intergenic
1094514386 12:31118808-31118830 CTCAGTCCCCGACTCGTGGGCGG - Intergenic
1094514499 12:31119253-31119275 CTCAGTCCCCGAATCGCGTGGGG - Intergenic
1094514526 12:31119333-31119355 CTCAGTCCCCGCCTCGCGGTGGG - Intergenic
1094514576 12:31119491-31119513 CTCAGTCCCTGCCTCGCGGGGGG - Intergenic
1094514602 12:31119571-31119593 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1094514631 12:31119653-31119675 CTCAGTTCCTGCCTCGCAGGGGG - Intergenic
1094514658 12:31119731-31119753 CTCAGTCCCCGCCTCGTGTGGGG - Intergenic
1094514687 12:31119811-31119833 CTCCGTCCCTGCCTCTCGGGGGG - Intergenic
1094514709 12:31119889-31119911 CTCAGTACCCGCCTCGCGTGGGG - Intergenic
1094514752 12:31120044-31120066 CGCAGTCCCCGCCTCGCATGTGG - Intergenic
1094514802 12:31120203-31120225 CTCAGTCCCCGCGTCGCGGAGGG - Intergenic
1094514830 12:31120283-31120305 CTCAGTCCCCGCATCGCGTGGGG - Intergenic
1094514892 12:31120454-31120476 TCTAGTCCCCGCCTCGCGGGGGG - Intergenic
1094514977 12:31120810-31120832 CTCAGTCCCCGCTTCGCGGGGGG - Intergenic
1094515007 12:31120892-31120914 CTCAGTCCCCGCCTCTCAGGGGG - Intergenic
1094515035 12:31120972-31120994 CTCACTCCCCGCCTCGCGGGGGG - Intergenic
1094515067 12:31121051-31121073 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1094515329 12:31122464-31122486 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1094515360 12:31122544-31122566 CTCAGTCCCCCCCTCGCGGGGGG - Intergenic
1094515423 12:31122702-31122724 CTCAGTCCCCGCCTCGCGGGCGG - Intergenic
1094515449 12:31122781-31122803 CTCAGTCCCTGCCTCGCGGGGGG - Intergenic
1094515478 12:31122860-31122882 CTCAATCCCCACCTCACGGGGGG - Intergenic
1094515508 12:31122939-31122961 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1096522298 12:52191313-52191335 CCCAGTCCCTGCCTGGGTGGTGG + Intronic
1096741224 12:53695565-53695587 CTGAGTCACAGCCTCCCGGGAGG - Intergenic
1096744194 12:53714894-53714916 CTTAGTCTCTGCCTCTCGAGTGG + Intronic
1098290568 12:68953635-68953657 CTCAGTCCCTGCCCTGATGGTGG + Intronic
1102499808 12:113344169-113344191 TGCAGTCCCAGCCTCTCGGGAGG + Intronic
1103210891 12:119165513-119165535 CTTGGTCCCTGCCTCTCGGGAGG - Intergenic
1106193124 13:27471682-27471704 CTCAGTCCCTGGTTAGCAGGAGG - Intergenic
1107545161 13:41428007-41428029 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1107545190 13:41428089-41428111 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1107787343 13:43969700-43969722 CTCAGGCCCTGCCTCGGGGTTGG - Intergenic
1107940213 13:45376524-45376546 CTCAGTCCCTACCTCGTGGGGGG + Intergenic
1107940374 13:45377283-45377305 CTCAGTCCCCGCCTTGCTGGGGG + Intergenic
1107940408 13:45377363-45377385 CTCAGTCCCCGCCTCGTGGGGGG + Intergenic
1107940435 13:45377442-45377464 CTCAGTCCCTGCCTTGTTGGGGG + Intergenic
1107940464 13:45377520-45377542 CTCAGTACCTGCCTCATTGGGGG + Intergenic
1107940489 13:45377600-45377622 CTCAGTCCCCACCTCGTGGGGGG + Intergenic
1107940515 13:45377679-45377701 CTGCGTCCCTGCCTCGTGGGGGG + Intergenic
1107940541 13:45377759-45377781 CTCAGTCCCTGCCTCGTGGGGGG + Intergenic
1107940571 13:45377838-45377860 CTCAGTCCCCGCCTCGTGGGGGG + Intergenic
1107940602 13:45377916-45377938 CTCAGTCCCTGCCTCGTTGGGGG + Intergenic
1107940632 13:45377995-45378017 CTCAGTCCGTGCCTGGCGGGGGG + Intergenic
1107941045 13:45380067-45380089 CTCAGTCCCCGCCTCGTGGGGGG + Intergenic
1107941077 13:45380146-45380168 CTCAGTCCCTGCCTCGTTGGGGG + Intergenic
1107941103 13:45380224-45380246 CTCAGTCCCAGCCTCGTGGGGGG + Intergenic
1107941131 13:45380303-45380325 CTGAGTCCCTGCCTCGTGGGGGG + Intergenic
1107941191 13:45380459-45380481 CTCAGTCCCTGCCTCGTTGGGGG + Intergenic
1107941221 13:45380538-45380560 CTCAGTCCGTGCCTGGCGGGGGG + Intergenic
1107941383 13:45381283-45381305 CTCAGTCCCTGCCTCCCGGGGGG + Intergenic
1107941414 13:45381361-45381383 CTCAGTCCCTGCCTCGTTGGGGG + Intergenic
1107941460 13:45381519-45381541 CTCAGTCCCCGCCTCGTAGGGGG + Intergenic
1107941491 13:45381598-45381620 CTGAGTCCCTGCCTCGTGGGGGG + Intergenic
1107941520 13:45381683-45381705 CTCAGTCCCTGCCTCACGGGGGG + Intergenic
1107941549 13:45381764-45381786 CTCAGTCCCCGCCTCGTGGGGGG + Intergenic
1107941579 13:45381842-45381864 CTCAGTCCCTGCCTCGTTGGGGG + Intergenic
1107941605 13:45381922-45381944 CTCAGTCCCCGCCTCGTGGGGGG + Intergenic
1107941634 13:45382001-45382023 CTGAGTCCCTGCCTCGTGGGGGG + Intergenic
1107941660 13:45382081-45382103 CTCAGTCCCTGCCTCGTGGGGGG + Intergenic
1107941690 13:45382160-45382182 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1107941721 13:45382238-45382260 CTCAGTCCCTGCCTCGTTGGGGG + Intergenic
1107941747 13:45382317-45382339 CTCAGTCCCCGCCTCGTGGGGGG + Intergenic
1107941776 13:45382396-45382418 CTGAGTCCCTGCCTCGTGGGGGG + Intergenic
1107941824 13:45382555-45382577 CTCAGTCCGTGCCTCGCAGAGGG + Intergenic
1107942111 13:45383971-45383993 CTCAGTCCCTGCCTCGTGGGGGG + Intergenic
1108052929 13:46463823-46463845 ATTACTCCCTGCATCGCGGGGGG - Intergenic
1108053007 13:46464112-46464134 CTCAGTCCCTGCCTCGTGGGGGG - Intergenic
1108053037 13:46464191-46464213 CTCAGTCCCTGCCTCGTGGGGGG - Intergenic
1108053068 13:46464269-46464291 CTCAGTCCCTGCCTTGTTGGGGG - Intergenic
1108053095 13:46464347-46464369 CTCGGTCCCTGCCTTGTTGGGGG - Intergenic
1108053127 13:46464426-46464448 CTGAGTCCCCGCCTCGTTGGGGG - Intergenic
1108053158 13:46464505-46464527 CTGAGTCCCCGCCTCGTGGGGGG - Intergenic
1108053191 13:46464586-46464608 CTCAGTCCCCACCTCGCTGGGGG - Intergenic
1108053372 13:46465431-46465453 TTCAGTCCCCGCCTCGCAGGGGG - Intergenic
1108053396 13:46465510-46465532 CTCAGTCCCCGCCACACGGGGGG - Intergenic
1108053425 13:46465589-46465611 CTCGGTCCCTGCCTCGTGGGGGG - Intergenic
1108053457 13:46465676-46465698 CTCAGTCCCTGCCTCGTGGGGGG - Intergenic
1108053491 13:46465755-46465777 CTCAGTCCCCGCCTCGCCGGGGG - Intergenic
1108053805 13:46467266-46467288 CTCAGTCCCCGCCTCGCAGGGGG - Intergenic
1108053830 13:46467346-46467368 CTCAGTCCCTGCCTCGTGGGGGG - Intergenic
1108053861 13:46467426-46467448 CTGCGTCCCTGCCTCGTGGGGGG - Intergenic
1108053890 13:46467505-46467527 CTCAGTCCCCGCCTCGTGGGGGG - Intergenic
1108053915 13:46467585-46467607 CTCAGTCCCTGCCTCGTTGGGGG - Intergenic
1109537114 13:63737480-63737502 CTCAGTTCCCGCCTCGCGGCGGG + Intergenic
1109537146 13:63737564-63737586 GTCAGTCCCCGCCTCCCGGGGGG + Intergenic
1109537176 13:63737644-63737666 TTCAGTACCCGCCTCGCGGGGGG + Intergenic
1109537482 13:63739083-63739105 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1109537515 13:63739165-63739187 GTCAGTCCCTCCCTCGTGGGTGG + Intergenic
1109537537 13:63739245-63739267 CTCAGTCCCCGCTTCGCGAGGGG + Intergenic
1109537644 13:63739562-63739584 CTCAGTCCCCGCCTCGCGGAGGG + Intergenic
1109537924 13:63740975-63740997 CTCAGTCCCTGTCTCACGGGGGG + Intergenic
1109537952 13:63741053-63741075 GTCAGTCCCTCCCTCGTGGGGGG + Intergenic
1109538031 13:63741292-63741314 CTGAGTTCCCGCCTCGCGGGGGG + Intergenic
1109538081 13:63741450-63741472 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1109538105 13:63741530-63741552 CTCAGTCCCGGCCTCGTGGGGGG + Intergenic
1109538150 13:63741688-63741710 CTGAGTCCCCGCCTCGCGGGGGG + Intergenic
1109538204 13:63741846-63741868 CTCAGTCCCTTCCTCGCGGGGGG + Intergenic
1109538230 13:63741926-63741948 CTCAGTCGCCGCCTCGCGGGGGG + Intergenic
1109538280 13:63742083-63742105 CTGAGTCCCTGCCTCTCGGGGGG + Intergenic
1109538331 13:63742243-63742265 CTCAGTCCCTGCCTCAGTGGGGG + Intergenic
1109545508 13:63837529-63837551 CTCAGTCCCTGCCTCAGTGGGGG - Intergenic
1109545558 13:63837689-63837711 CTGAGTCCCTGCCTCTCGGGGGG - Intergenic
1109545607 13:63837846-63837868 CTCAGTAGCCGCCTCGCGGGGGG - Intergenic
1109545632 13:63837926-63837948 CTCAGTCCCTTCCTCGCGGGGGG - Intergenic
1109545815 13:63838751-63838773 CTCAGTCCCCGCCTCATGGGAGG - Intergenic
1109545900 13:63838993-63839015 CTCAGTCCCCGCCTCTCGGAGGG - Intergenic
1109546179 13:63840407-63840429 CTCAGTCCCCGCCTCGCGGAGGG - Intergenic
1109546315 13:63840800-63840822 CTCAGTTCCTGCCTGGCGGGGGG - Intergenic
1109546339 13:63840879-63840901 CTCAGTCCCTGCCTCATGGGCGG - Intergenic
1109546391 13:63841038-63841060 GTCAGTACCCGCCTCGCGGGGGG - Intergenic
1109546516 13:63841434-63841456 CTCAGTCCCCACCTCGCGGGTGG - Intergenic
1109546664 13:63842177-63842199 CTCAGTCCCCGCCTCGCGGAGGG - Intergenic
1109546713 13:63842335-63842357 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1109547038 13:63843906-63843928 CTCAGTCCCCGCCTCACAGAGGG - Intergenic
1109547132 13:63844221-63844243 CTTACTCCCTGCCTCGCGGGGGG - Intergenic
1109840839 13:67914849-67914871 CTTACTCCCCGCATCGCGGGGGG - Intergenic
1110891537 13:80704380-80704402 CTCAATCCCTGCCTCGCGGGGGG - Intergenic
1110891595 13:80704538-80704560 CTCAGTTCCCGCCTTGCGGGCGG - Intergenic
1110891646 13:80704700-80704722 CTCAGTTCCCGCCTCACAGGGGG - Intergenic
1110891796 13:80705448-80705470 CTCAGTCCCCGCCTCGTGGGGGG - Intergenic
1110891892 13:80705762-80705784 CTCCATCCCCGCCTCGCGAGGGG - Intergenic
1110891916 13:80705842-80705864 CTCAGTCCCTGCCTCGCAGTGGG - Intergenic
1110891945 13:80705920-80705942 CTGAGTCCCCGCCTCACGGGGGG - Intergenic
1110891977 13:80705999-80706021 CTTAGTCCCCACCTCGCTGGGGG - Intergenic
1110892005 13:80706078-80706100 CTCAGTCCCTACCTCATGGGGGG - Intergenic
1110892046 13:80706197-80706219 CTCAGTCCCTGCCTCGCGGGGGG - Intergenic
1110892251 13:80707100-80707122 CTCAGTCCCCGCCTCACGGAGGG - Intergenic
1110892304 13:80707259-80707281 CTCAGTCCACACCTCACGGGGGG - Intergenic
1110892357 13:80707420-80707442 CTCAGTCCCCGCCTCGCAGGGGG - Intergenic
1110892387 13:80707500-80707522 CTCAGTCCCGGCCTCGCGGGAGG - Intergenic
1110892415 13:80707579-80707601 CTCAGTTCCCGCCTAGAGGGCGG - Intergenic
1110892466 13:80707741-80707763 CTCAGTCCCCGCCTCGGAGGGGG - Intergenic
1110892494 13:80707820-80707842 CTCAGTACCCGCCTCGCGGGGGG - Intergenic
1111602749 13:90495009-90495031 CCCAAGCCCTGCCCCGCGGGAGG - Intergenic
1113925929 13:113941676-113941698 CACAGTTCCAGCCTCGCAGGTGG + Intergenic
1117037735 14:51744801-51744823 CTTACTCCCCGCATCGCGGGGGG - Intergenic
1117547910 14:56808488-56808510 CTTCCTCCCTCCCTCGCGGGTGG - Intronic
1119101510 14:71884226-71884248 CGGAGTCCCTGGCTCGCAGGAGG - Intergenic
1120031875 14:79650906-79650928 CTCAATCCCTGCCTCTTGGGAGG - Intronic
1121107265 14:91289207-91289229 CTCAGACCCCGCCTCGCCGGCGG - Exonic
1122293487 14:100692328-100692350 CTCAGTCCCTGCCCGGCGCCGGG + Intergenic
1122436811 14:101706278-101706300 CCCTGTCCCTGCCTCCGGGGCGG - Intergenic
1122479788 14:102039560-102039582 CTCAGCCGCTCCCTGGCGGGGGG + Intronic
1122978764 14:105181714-105181736 CACAGTCCCTCCCTCCCTGGGGG - Intergenic
1123201682 14:106671927-106671949 TCCAGTCCCTTCCTTGCGGGGGG + Intergenic
1125532348 15:40421919-40421941 CCCAGTCCCTGCCTGCCGGGTGG + Intronic
1129428268 15:75480775-75480797 TCCAGCCGCTGCCTCGCGGGCGG - Intronic
1130764483 15:86856206-86856228 CTCTGTCCCTGCCTCCCCAGAGG + Intronic
1130828441 15:87573621-87573643 GTCAGTCCCTCCCTCCCAGGAGG + Intergenic
1131077716 15:89506245-89506267 CTGAGGCCCTGCCCTGCGGGAGG - Intergenic
1131811759 15:96180452-96180474 CTGTGCCCCTGCCTCGAGGGAGG + Intergenic
1132595667 16:748202-748224 CCGAGGCCCTGCCTCCCGGGTGG + Intronic
1133285073 16:4686903-4686925 CTCAGTCCCTGTCTCTTGGAGGG + Intronic
1134057680 16:11180750-11180772 CTCACTCCATGCCACACGGGTGG + Exonic
1134457080 16:14402541-14402563 CTGGGTCCATGCCTCGCTGGAGG - Intergenic
1136866937 16:33766665-33766687 CTCAGGCCCTGCCTCCCTGGCGG + Intergenic
1137456305 16:48620673-48620695 CTCAGTCCCTTCCTAGTGGTGGG - Intergenic
1138718837 16:59055029-59055051 CACAGTCCCTGCCACACAGGAGG - Intergenic
1141070329 16:80948691-80948713 CTCAGCCTCTGCCTCGGGGTGGG + Intergenic
1203105225 16_KI270728v1_random:1349537-1349559 CTCAGGCCCTGCCTCCCTGGCGG - Intergenic
1203128289 16_KI270728v1_random:1612831-1612853 CTCAGGCCCTGCCTCCCTGGCGG + Intergenic
1142899264 17:3002375-3002397 CTCAGTGTCTGCCTGGCAGGTGG - Intronic
1143096773 17:4482564-4482586 GGCAGCCCCTGCCTCTCGGGGGG + Intronic
1144328821 17:14206524-14206546 CTCAGACCCTGCTTCACAGGGGG - Intronic
1145747819 17:27333052-27333074 CTCGGGCGCTGCCTCTCGGGCGG - Intergenic
1147741568 17:42673483-42673505 CTCAGCCTCTGCCTGGCGTGGGG + Exonic
1148599233 17:48881492-48881514 CACAGTACCTGCCTCTCAGGTGG + Intergenic
1148745771 17:49917213-49917235 CTCAGTCACTGCCTTGCTGAGGG - Intergenic
1152168038 17:78723630-78723652 CCCATTCCCGGCCTCCCGGGGGG + Intronic
1152341495 17:79728346-79728368 CTCAGGCCCTGCCTCCCTGGCGG + Intergenic
1157625119 18:49044749-49044771 CTCAGTCTCTTCCTCCCTGGAGG + Intronic
1160778725 19:868499-868521 CTCAGTGCCTGCCTCCCCGCAGG - Exonic
1161140696 19:2646006-2646028 CACGTTCCCTGCCTCGTGGGCGG + Intronic
1161318714 19:3631365-3631387 CTCTGCCCCTGCCTCCCCGGGGG + Exonic
1162063583 19:8111310-8111332 CTCAGTCCCTGACTTGGGGGTGG + Intronic
1162680531 19:12337322-12337344 TGCAGTCCCAGCCTCTCGGGAGG - Intergenic
1163007586 19:14406312-14406334 CTCCGTCCCCGCCCCGCAGGTGG + Exonic
1164540904 19:29120888-29120910 GTCAGTCCCTTCCTTGCGAGGGG - Intergenic
1165181259 19:33972959-33972981 CTCAGTCACTGCCACGCAGATGG - Intergenic
1166788379 19:45382954-45382976 CTCTGACCCTGCCTCGGGAGTGG - Intronic
1167390784 19:49193607-49193629 CTCAGCCCCAGCCTCTCTGGGGG - Intronic
1167574606 19:50312110-50312132 CTCCCTCCCTGCCCTGCGGGTGG + Intronic
1168292540 19:55363538-55363560 CTCAGACCCTGCCTCCACGGAGG + Intergenic
1168349497 19:55668068-55668090 CTCAGTCCCGGCCGGGCGCGGGG - Intronic
926116491 2:10217101-10217123 CTGAGCCCCTGCCTCCCGGCAGG + Intergenic
932352127 2:71041355-71041377 CTTACTCCCCGCATCGCGGGTGG - Intergenic
933384219 2:81589634-81589656 CTCAGTACCTGCATCTGGGGTGG + Intergenic
933457238 2:82531066-82531088 CTTAGTCCCCGCATCGCGGGGGG + Intergenic
936019262 2:108982326-108982348 CTCAGACCCTCCCTGGTGGGAGG + Intronic
936151050 2:110022688-110022710 CTCAGTCCCTGCCTCGGCTGGGG - Intergenic
936159800 2:110076290-110076312 CTCTGTCCCTGGCTTGCAGGTGG + Intergenic
936184865 2:110295063-110295085 CTCTGTCCCTGGCTTGCAGGTGG - Intergenic
936193627 2:110348681-110348703 CTCAGTCCCTGCCTCGGCTGGGG + Intergenic
942531886 2:176919406-176919428 CTCAGTACCTGCCTCATGGTAGG - Intergenic
943842905 2:192602841-192602863 CTTACTCCCCGCATCGCGGGTGG - Intergenic
946839294 2:223804207-223804229 CTCAGCCACTGCCTGGCTGGTGG - Intronic
947610634 2:231522910-231522932 CTAAGTCCCTGGCTCGGGGGAGG - Intergenic
947637622 2:231688125-231688147 AGCAGTCCCTGCCTTGCAGGTGG + Intergenic
948836349 2:240627939-240627961 CTGGGACCCTGCCTCGTGGGAGG - Intronic
1169074496 20:2752557-2752579 CCCAGACCTTCCCTCGCGGGCGG - Intronic
1170449310 20:16465917-16465939 CTCAGACCCTGCCTGGCATGTGG + Intronic
1171395401 20:24829724-24829746 CTCTGTCTCTGCCTCTCGTGAGG - Intergenic
1172116319 20:32575493-32575515 CTCAGGCCCTGTCCCGTGGGAGG + Intronic
1172961836 20:38805640-38805662 CTCAGGCCCCGCCTTGGGGGAGG + Intergenic
1175267567 20:57711680-57711702 CTCAGCCCCTGCCTTGAGGAAGG + Intergenic
1176053818 20:63134503-63134525 CTCAGGCCCTGCCTCCCCTGTGG - Intergenic
1176054068 20:63135068-63135090 CTCAGGCCCTGCCTCCCCTGTGG - Intergenic
1176159881 20:63642527-63642549 CCCCGTCCCTGCCTCGCGCGCGG + Intronic
1176239887 20:64070978-64071000 CTCAGTCCCTGCCATGGAGGTGG + Intronic
1176265133 20:64205302-64205324 GGAAGTCGCTGCCTCGCGGGAGG - Intronic
1178673830 21:34614660-34614682 CCCAGTCCCGGCCGCGCGCGGGG - Intronic
1178924251 21:36761827-36761849 ATGAGCCCCTGCCTCGCCGGCGG + Intronic
1179834317 21:44019385-44019407 CTCAGTGCCTGCCTCTGTGGTGG + Intronic
1180946039 22:19694074-19694096 CTCTCTCCTTGCCTTGCGGGTGG - Intergenic
1181046772 22:20218336-20218358 CACAGCCCCTGACTCTCGGGTGG + Intergenic
1181139351 22:20792707-20792729 CACAGTCCCTGCCTCCTGTGTGG - Intronic
1181733901 22:24867150-24867172 CACAGTCCCTACCTTGCTGGTGG - Exonic
1182338108 22:29598583-29598605 CTCAGTCCCAGCTACGCGGGAGG + Intergenic
1183116619 22:35697348-35697370 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1183271576 22:36865652-36865674 CTCAGCACCTGCCCCGCAGGAGG + Intronic
949883107 3:8676797-8676819 CTCAGTCCCCGCCTCACTGGGGG - Intronic
949883165 3:8676957-8676979 CTCAGTCCCCGCCTCACAGGGGG - Intronic
949883192 3:8677037-8677059 CGCAGTCCCCGCCTCCTGGGGGG - Intronic
949883217 3:8677117-8677139 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
949883467 3:8678501-8678523 CTCAGTCCCCGCCTCGCGGGGGG - Intronic
949883492 3:8678580-8678602 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
949883523 3:8678659-8678681 CTCAATCCCCGCCTCGCGGGGGG - Intronic
949883554 3:8678739-8678761 CTCTTTCCCCGCCTCGCGTGTGG - Intronic
949883602 3:8678903-8678925 CTCAGTCCCCGCCTGGCGGGGGG - Intronic
949883626 3:8678983-8679005 CTCAGTCCCCACCTCGCGGGGGG - Intronic
949883652 3:8679062-8679084 CTCAGTCCCCGCCTCGCGGGGGG - Intronic
949883731 3:8679296-8679318 CTTAGTCCCCGCCTCATGGGGGG - Intronic
949883791 3:8679457-8679479 CTCAGTCCCCGCCTCCCGGGGGG - Intronic
949883818 3:8679536-8679558 CTCAGTTCCTGCCTCGCTGAGGG - Intronic
949883846 3:8679616-8679638 CTCATTCCCCGCCTCACCGGGGG - Intronic
949884196 3:8681331-8681353 CTCAGTCCCCGAGCCGCGGGGGG - Intronic
949884220 3:8681410-8681432 CTCAGTCCCGGGCTCGCCGGGGG - Intronic
949884278 3:8681565-8681587 CTCAGTCCCCGCTTCGTTGGGGG - Intronic
949884333 3:8681722-8681744 CTCACTCCCCGCCTCCCAGGGGG - Intronic
953351628 3:42220574-42220596 CTCACCCCCTGCCTCGCCCGTGG - Intronic
955689274 3:61574927-61574949 CTCAGTCACTGCCTCGAGAATGG + Intronic
955729496 3:61969667-61969689 CTCAGTCCCTGCATCGTGCATGG + Intronic
957077299 3:75612077-75612099 TTCACTCCCTGCATCGCGGGGGG + Intergenic
957077330 3:75612160-75612182 CTCACTCCCCGCATCGCGGGGGG + Intergenic
961274461 3:125715994-125716016 CTGACTCCCTGCATAGCGGGGGG - Intergenic
961277399 3:125738627-125738649 CTTACTCCCCGCATCGCGGGGGG - Intergenic
961522274 3:127473654-127473676 CTCAGGCCCTGCCTCTAAGGGGG + Intergenic
961877027 3:130031041-130031063 CTTACTCCCCGCATCGCGGGGGG + Intergenic
967944993 3:194797341-194797363 CTCAGGCCCTGGGTGGCGGGTGG + Intergenic
968915219 4:3494284-3494306 CTCAGCCCCTGCGTCGGAGGTGG + Exonic
968989305 4:3898231-3898253 CTTACTCCCCGCATCGCGGGGGG + Intergenic
969025869 4:4171809-4171831 CTTACTCCTTGCATCGCGGGGGG + Intergenic
969730876 4:8956916-8956938 CTTACTCCCCGCATCGCGGGGGG - Intergenic
969730908 4:8956997-8957019 CTTACTCCCCGCATCGCGGGGGG - Intergenic
969785030 4:9450825-9450847 CTTACTCCCCGCATCGCGGGGGG - Intergenic
969790496 4:9491102-9491124 CTTACTCCCCGCATCGCGGGGGG - Intergenic
969790523 4:9491185-9491207 CTTACTCCCCGCATCGCGGGGGG - Intergenic
969790838 4:9493338-9493360 CTTACTCCCCGCATCGCGGGGGG - Intergenic
969792741 4:9503259-9503281 CTTACTCCCCGCATCGCGGGGGG - Intergenic
969826006 4:9758880-9758902 CTTACTCCCCGCGTCGCGGGGGG - Intergenic
975335282 4:73169403-73169425 CTCAGTCCCTGGCTCCCAGATGG + Intronic
978127541 4:105152200-105152222 CGCAGCCTCTGCCTCCCGGGAGG - Intronic
980570838 4:134617907-134617929 CTCCGTCACAGCCTCCCGGGTGG - Intergenic
984617774 4:181917781-181917803 TGCAGTCCCGGCCTCTCGGGAGG - Intergenic
985537601 5:473655-473677 CCCAGGCCCTGCAGCGCGGGAGG + Intronic
989171417 5:38473145-38473167 GTCAGCCGCTGCCTTGCGGGAGG - Intergenic
992098269 5:73381921-73381943 CTCAGTGCCTGCCTCGGGCTCGG - Intergenic
997941858 5:138165068-138165090 CTCAGTCCCTGCCTGGCCCCTGG - Exonic
998154452 5:139776440-139776462 CTCAGCCCCTGCCTTGCTGCAGG - Intergenic
998928900 5:147158441-147158463 CTCAGTCCCAGCCTTAGGGGAGG + Intergenic
999710976 5:154318114-154318136 CTCATTCCTTGCCTTGAGGGTGG - Intronic
1003143516 6:3491212-3491234 CTCCGTCCTTGGCTTGCGGGTGG - Intergenic
1003597034 6:7482675-7482697 CTCCTGCCCTGCCTCGTGGGCGG - Intergenic
1003881376 6:10482851-10482873 CCCAAGCCCTGCCCCGCGGGAGG + Intergenic
1006199135 6:32270720-32270742 CTCACTCCCCGCATCGCGGGGGG - Intergenic
1009937535 6:70251423-70251445 TTCAGTCCCAGCCACTCGGGAGG + Intronic
1015542919 6:134334098-134334120 CTTAGTCCCAGCCTCTCAGGAGG - Intergenic
1016758027 6:147708285-147708307 CTCACTCCTTGGCTCGCGGATGG - Intronic
1019462283 7:1166845-1166867 CTGAGTCCCAGCCACTCGGGAGG + Intergenic
1019744916 7:2694250-2694272 CTCATTTCCTGCCTCGCCGCTGG + Intronic
1019761184 7:2813996-2814018 CTCATTTCCTGCCTCGCCGCCGG + Intronic
1021794280 7:24237730-24237752 CTCAGTCCTTGTCTCGCTGAAGG + Intergenic
1026212285 7:68316304-68316326 CTCATTCCCTGCCTTCTGGGTGG + Intergenic
1032023140 7:128421271-128421293 CTAAGTCCCTGCCTCTTGGCAGG + Intergenic
1034303149 7:150033577-150033599 CTCAGTCCCCGCCTCGCAGGAGG + Intergenic
1034303177 7:150033657-150033679 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034303230 7:150033818-150033840 CTCAGTCCCTGCCTCGTGGGGGG + Intergenic
1034303254 7:150033898-150033920 CTCAGTCCCCGCGTCGCGAGGGG + Intergenic
1034303313 7:150034054-150034076 CTGAGTCCCCGCCTCGCGGGGGG + Intergenic
1034303462 7:150034797-150034819 CTCAGTCCCCGCCTCGTGGGGGG + Intergenic
1034303489 7:150034877-150034899 CTCAGTCCCTACCTCGCGGGGGG + Intergenic
1034303577 7:150035185-150035207 CTCAGTCCCCGCCTCACGGGGGG + Intergenic
1034303659 7:150035428-150035450 CTCAGTCCCTGACTCGCGGGGGG + Intergenic
1034303739 7:150035733-150035755 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1034303820 7:150035976-150035998 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034303842 7:150036055-150036077 CTCAGTCCCCGCGTCGCGAGGGG + Intergenic
1034303872 7:150036134-150036156 CTGAGTCCCCGCCTCGTGGGGGG + Intergenic
1034304054 7:150036966-150036988 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034304112 7:150037128-150037150 CTCAGTCCCTGCCTCGTGGGGGG + Intergenic
1034304171 7:150037354-150037376 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1034304198 7:150037435-150037457 CTCAATCCCTGCCTCGCGGGGGG + Intergenic
1034304318 7:150037823-150037845 CTCAGTCCCTGCCTCGCGGAGGG + Intergenic
1034304343 7:150037903-150037925 CTCAGTCCCCGCGTCGCGAGGGG + Intergenic
1034304397 7:150038060-150038082 CTGAGTCCCCACCTCGCGGGGGG + Intergenic
1034304543 7:150038782-150038804 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1034304573 7:150038863-150038885 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034304657 7:150039172-150039194 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1034304865 7:150039799-150039821 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034304939 7:150040036-150040058 CTGAGTCCCCGCCTCGCGGGGGG + Intergenic
1034305088 7:150040782-150040804 CTCAGTCCCCGCCTTGCGGGGGG + Intergenic
1034305233 7:150041529-150041551 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1034305263 7:150041610-150041632 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034305323 7:150041773-150041795 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034305408 7:150042080-150042102 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034305437 7:150042161-150042183 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034305496 7:150042323-150042345 CTCAGTCCCTGCCTCGCGGGGGG + Intergenic
1034305521 7:150042403-150042425 CTCAGTCCCCGCGTCGCGAGGGG + Intergenic
1034305572 7:150042560-150042582 CTGAGTCCCCGCCTCGCGGGGGG + Intergenic
1034305720 7:150043306-150043328 CTCAGTCCCCGCCTTGCGGGGGG + Intergenic
1034801123 7:154057344-154057366 CTCAGTCCCCGCCTCGCGGGGGG - Intronic
1034801331 7:154058250-154058272 CTCAGTCCCCGCATCACGAGGGG - Intronic
1034801355 7:154058330-154058352 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
1034801410 7:154058491-154058513 CTCAGTCCCTGCCTCGCGGAGGG - Intronic
1034801437 7:154058572-154058594 CTCAGTCCCCGCCTCGCGGGGGG - Intronic
1034801549 7:154058960-154058982 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
1034801577 7:154059040-154059062 CTCAGTCCCCGCCTCGTGGGGGG - Intronic
1034801630 7:154059202-154059224 CTCAGTCCCTACCTCGCGGGGGG - Intronic
1034801657 7:154059282-154059304 CTCAGTCCCCGCCTCAAGGGGGG - Intronic
1034801807 7:154060024-154060046 CTGAGTCCCCGCCTCGCGGGGGG - Intronic
1034801886 7:154060260-154060282 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
1034801915 7:154060340-154060362 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
1034801945 7:154060421-154060443 CGCAGTCCCCGCCTCGCGGGGGG - Intronic
1034802029 7:154060728-154060750 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
1034802055 7:154060808-154060830 CTCAGTCCCTGCCTCATGGGGGG - Intronic
1034802080 7:154060888-154060910 CTCAGTCCCCGCCTCGTGGGGGG - Intronic
1034802230 7:154061631-154061653 CTGAGTCCCCGCCTCGCAGCGGG - Intronic
1034802283 7:154061788-154061810 CTCAGTCCCCGCGTCGCGAGGGG - Intronic
1034802307 7:154061868-154061890 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
1034802365 7:154062029-154062051 GTCAGTCCCTGCCTCGCGGGGGG - Intronic
1034802394 7:154062110-154062132 CTCAGTCCCCGCCTCGCGGGGGG - Intronic
1034802483 7:154062416-154062438 CTCAGTCCCTGCCTAGCGGAGGG - Intronic
1034802541 7:154062578-154062600 CTCAGTCCCTGCCTAGCGGAGGG - Intronic
1034802596 7:154062741-154062763 CTCAGTCCCTGCCTCGCGGAGGG - Intronic
1034802624 7:154062822-154062844 CGCAGTCCCCGCCTCGCGGGGGG - Intronic
1034802736 7:154063211-154063233 CTCAGTCCCTGCCTCGCGGGGGG - Intronic
1034802766 7:154063291-154063313 CTCAGTCCCCGCCTCATGGGGGG - Intronic
1034802818 7:154063452-154063474 CTCAGTCCCTGCCTCGCGGGAGG - Intronic
1034802867 7:154063612-154063634 CTCAGTCCCTGCCTCGTGGGGGG - Intronic
1034802897 7:154063692-154063714 CTCAGTCCCCACCTCACGGGAGG - Intronic
1036213736 8:6863068-6863090 CTCAGTACCTGCTTTGCGGTGGG + Intergenic
1036765272 8:11546000-11546022 TTCAGTCCCTGCTGCGTGGGTGG - Intronic
1036818151 8:11917088-11917110 ATTACTCCCTGCATCGCGGGGGG + Intergenic
1036833961 8:12043090-12043112 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1036855807 8:12289655-12289677 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1036904135 8:12693501-12693523 CTTACTCCCCGCATCGCGGGAGG + Intergenic
1037339269 8:17825240-17825262 CACAGTCCCTGCTACTCGGGAGG + Intergenic
1038396708 8:27251129-27251151 CTCAGTCCCAGCTACTCGGGAGG + Intronic
1038572490 8:28674902-28674924 CTCAGCACCTGCCTCAGGGGAGG - Intronic
1042710561 8:71712776-71712798 CCCAGGCCATGCCTCGGGGGAGG + Intergenic
1044243289 8:89911814-89911836 GTCAGTCCCAGCTTCTCGGGAGG + Intronic
1047013068 8:120693154-120693176 CTCACTCACTGCCTCGGGGCGGG + Intronic
1047687111 8:127315864-127315886 CCCAGCCGCTGCCTCCCGGGCGG - Intergenic
1048202129 8:132383263-132383285 CTCAGGCCCTGCCTGCCGTGTGG - Intronic
1048618984 8:136110508-136110530 TGCAGTCCCAGCTTCGCGGGAGG + Intergenic
1051404921 9:16727048-16727070 CTCCGTCCCGGCCGCGCTGGAGG - Intronic
1053736143 9:41104220-41104242 GTCAGTCCCCTCCTCGCGGGGGG - Intergenic
1053736201 9:41104601-41104623 CTCAGTCACCGCCTCGCGGGGGG - Intergenic
1053736228 9:41104681-41104703 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1053736254 9:41104761-41104783 CTGAGACCCCGCCTCGCGGGGGG - Intergenic
1053736543 9:41106613-41106635 CTCAGTCCCCGCCTTGCGGGGGG - Intergenic
1053736620 9:41106851-41106873 CTCAGTCCCCGCCTCGCGAGGGG - Intergenic
1053736642 9:41106930-41106952 CTGAGTCCTTGCCTCGCGGGGGG - Intergenic
1053736689 9:41107087-41107109 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1053736728 9:41107192-41107214 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1053736757 9:41107268-41107290 GTCAGTCCCCGCCACGCGGGGGG - Intergenic
1053736783 9:41107347-41107369 CTCAGTCCCCGCCTCACGGGGGG - Intergenic
1053736809 9:41107427-41107449 CTTAGACACCGCCTCGCGGGGGG - Intergenic
1053736979 9:41108254-41108276 CTCTGTCCCCGCCTCGCCGGGGG - Intergenic
1053737005 9:41108334-41108356 CTCAGTCCCTGCCTCGCGGGTGG - Intergenic
1053737031 9:41108414-41108436 CTCAGTCCCCACCTCGCGAGGGG - Intergenic
1053737145 9:41108733-41108755 CTCAGTCCCCGCCTCGCGGGAGG - Intergenic
1053737173 9:41108813-41108835 CTCAGTCCCCGCCTCGCGGGAGG - Intergenic
1053737202 9:41108895-41108917 CGCAGTCCCTGTCTCGCGGGGGG - Intergenic
1053737229 9:41108974-41108996 CTCAGTCCCCGCCTCGCGGGGGG - Intergenic
1053737304 9:41109204-41109226 CTTACTCCCCGCATCGCGGGGGG - Intergenic
1054456146 9:65431427-65431449 CTCACTCCCTGCCTGGCCCGGGG + Intergenic
1054691045 9:68322115-68322137 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1054691120 9:68322345-68322367 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1054691147 9:68322424-68322446 CGCAGTCCCTGTCTCGCGGGGGG + Intergenic
1054691175 9:68322504-68322526 CTCAGTCCCCGCCTCGCGGGAGG + Intergenic
1054691203 9:68322584-68322606 CTCAGTCCCCGCCTCGCGGGAGG + Intergenic
1054691317 9:68322903-68322925 CTCAGTCCCCACCTCGCGAGGGG + Intergenic
1054691343 9:68322983-68323005 GTCAGTCCCCACCTCGCGAGGGG + Intergenic
1054691369 9:68323063-68323085 GTCAGTCCCTGCCTCGCGGGTGG + Intergenic
1054691395 9:68323143-68323165 CTCTGTCCCCGCCTCGCCGGGGG + Intergenic
1054691564 9:68323970-68323992 CTTAGACACCGCCTCGCGGGGGG + Intergenic
1054691590 9:68324050-68324072 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1054691616 9:68324129-68324151 GTCAGTCCCCGCCACGCGGGGGG + Intergenic
1054691645 9:68324208-68324230 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1054691682 9:68324313-68324335 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1054691730 9:68324471-68324493 CTGAGTCCTTGCCTCGCGGGGGG + Intergenic
1054691751 9:68324549-68324571 CTCAGTCCCCGCCTCGCGAGGGG + Intergenic
1054691828 9:68324787-68324809 CTCAGTCCCCGCCTTGCGGGGGG + Intergenic
1054692119 9:68326639-68326661 CTGAGACCCCGCCTCGCGGGGGG + Intergenic
1054692146 9:68326719-68326741 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1054692173 9:68326799-68326821 CTCAGTCACCGCCTCGCGGGGGG + Intergenic
1054692231 9:68327180-68327202 GTCAGTCCCCTCCTCGCGGGGGG + Intergenic
1055930110 9:81551491-81551513 CTCAGTCCCAGCTACGCGGGAGG + Intergenic
1056683603 9:88741410-88741432 CTCACTCCTTGCCTTGCAGGTGG - Intergenic
1056864795 9:90219883-90219905 CTCAGTCCCCGCATCGCGGGGGG - Intergenic
1056918232 9:90763003-90763025 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1056918260 9:90763082-90763104 CTTACTCCCCGCATCGCGGGGGG + Intergenic
1059433291 9:114262480-114262502 CTGTGTCCCTGCCTCTGGGGAGG + Intronic
1059525775 9:114989727-114989749 CTCAGTCTCTGCCTCTCAGTGGG + Intergenic
1060213263 9:121723378-121723400 TGCAGTCCCTGCCTCCCTGGAGG + Intronic
1061040432 9:128138442-128138464 CTCAGTCCCCGCCTCTCGGGGGG + Intergenic
1061040459 9:128138522-128138544 CTCAGTCCCCGCCTAGCGGGAGG + Intergenic
1061040516 9:128138680-128138702 CTCAGTCTCCGCCTCGCGGGGGG + Intergenic
1061040544 9:128138760-128138782 GTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1061040570 9:128138839-128138861 CTCAGTCCCCGCCTCGTGGGGGG + Intergenic
1061040601 9:128138920-128138942 CTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1061040629 9:128138999-128139021 CTCAGTCCCCGCCATGCTGGGGG + Intergenic
1061040678 9:128139157-128139179 CTCAGTCCCCGCCTCGCGTGAGG + Intergenic
1061040707 9:128139237-128139259 CTGAGTCCCCGCCTCGCGGGGGG + Intergenic
1061040732 9:128139317-128139339 CACAGTCCCCGCCTCGCCGTGGG + Intergenic
1061040763 9:128139396-128139418 GTCAGTTCCCGCCTAGCGGGGGG + Intergenic
1061040785 9:128139476-128139498 CTCAGTCCACGCCTCGCGGCTGG + Intergenic
1061040840 9:128139638-128139660 GTCAGTCCCCGCCTCGCGGGGGG + Intergenic
1061040893 9:128139797-128139819 CTCAGTCCCTGCGTCGCGGTGGG + Intergenic
1061811227 9:133163687-133163709 CCCAGTCCCTGCCACGCAAGGGG - Intronic
1061816352 9:133199727-133199749 CTCCGTCCCTGGCTCCCGGGAGG - Intergenic
1061995639 9:134181399-134181421 CTAAGTCCCTGCCACTCCGGGGG - Intergenic
1062170253 9:135130951-135130973 GCCAGGCCCTGCCTCGAGGGAGG - Intergenic
1062417142 9:136457307-136457329 CTCAGAACCTGCCTCTTGGGCGG - Intronic
1062607613 9:137355159-137355181 CTCAGTCCCTGCCGCTCATGGGG - Intronic
1188368456 X:29339016-29339038 CTCAGTACCTGCGGCTCGGGTGG - Intronic
1190333194 X:49248180-49248202 CTCAGACTCTGCCTGGCCGGTGG - Exonic
1190708277 X:53048492-53048514 CACGGTCCCTGCCTCAGGGGCGG - Intergenic
1190731412 X:53228491-53228513 GTCAGACCCTGTCTCCCGGGTGG - Intergenic
1192924991 X:75747043-75747065 CTGCGTCCCAGGCTCGCGGGCGG - Intergenic
1194589032 X:95773641-95773663 CTCAGTCCTTGCCTTGATGGAGG + Intergenic
1197768775 X:130075865-130075887 CTCAGTCACTGCCTGGATGGGGG + Intronic
1200056611 X:153464776-153464798 ATCAGTCCCTGCAGCGCTGGTGG - Intronic