ID: 1109538083

View in Genome Browser
Species Human (GRCh38)
Location 13:63741457-63741479
Sequence GGAGGCACCCCCCGCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109538083_1109538098 25 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538098 13:63741505-63741527 GCCAGGGGGGAAAGAGTGGCTGG No data
1109538083_1109538085 -9 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538085 13:63741471-63741493 GGTGCCTCCCGCCTCTGCGATGG No data
1109538083_1109538097 21 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538097 13:63741501-63741523 AAGAGCCAGGGGGGAAAGAGTGG No data
1109538083_1109538093 10 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538093 13:63741490-63741512 ATGGTGGTCCTAAGAGCCAGGGG No data
1109538083_1109538091 8 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538091 13:63741488-63741510 CGATGGTGGTCCTAAGAGCCAGG No data
1109538083_1109538095 12 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538095 13:63741492-63741514 GGTGGTCCTAAGAGCCAGGGGGG No data
1109538083_1109538092 9 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538092 13:63741489-63741511 GATGGTGGTCCTAAGAGCCAGGG No data
1109538083_1109538086 -6 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538086 13:63741474-63741496 GCCTCCCGCCTCTGCGATGGTGG No data
1109538083_1109538094 11 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538094 13:63741491-63741513 TGGTGGTCCTAAGAGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109538083 Original CRISPR GGAGGCACCCCCCGCGAGGC AGG (reversed) Intergenic
No off target data available for this crispr