ID: 1109538086

View in Genome Browser
Species Human (GRCh38)
Location 13:63741474-63741496
Sequence GCCTCCCGCCTCTGCGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109538084_1109538086 -10 Left 1109538084 13:63741461-63741483 CCTCGCGGGGGGTGCCTCCCGCC No data
Right 1109538086 13:63741474-63741496 GCCTCCCGCCTCTGCGATGGTGG No data
1109538076_1109538086 24 Left 1109538076 13:63741427-63741449 CCAGTGGGGAAGAGGGGCTGGCT No data
Right 1109538086 13:63741474-63741496 GCCTCCCGCCTCTGCGATGGTGG No data
1109538082_1109538086 -5 Left 1109538082 13:63741456-63741478 CCCTGCCTCGCGGGGGGTGCCTC No data
Right 1109538086 13:63741474-63741496 GCCTCCCGCCTCTGCGATGGTGG No data
1109538083_1109538086 -6 Left 1109538083 13:63741457-63741479 CCTGCCTCGCGGGGGGTGCCTCC No data
Right 1109538086 13:63741474-63741496 GCCTCCCGCCTCTGCGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109538086 Original CRISPR GCCTCCCGCCTCTGCGATGG TGG Intergenic
No off target data available for this crispr