ID: 1109547132

View in Genome Browser
Species Human (GRCh38)
Location 13:63844221-63844243
Sequence CTTACTCCCTGCCTCGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109547132_1109547152 28 Left 1109547132 13:63844221-63844243 CCCCCCGCGAGGCAGGGAGTAAG No data
Right 1109547152 13:63844272-63844294 AGGACCTCCATCACAGTGGGGGG No data
1109547132_1109547142 8 Left 1109547132 13:63844221-63844243 CCCCCCGCGAGGCAGGGAGTAAG No data
Right 1109547142 13:63844252-63844274 CCTCATCCCCCCTGGCTCATAGG No data
1109547132_1109547150 26 Left 1109547132 13:63844221-63844243 CCCCCCGCGAGGCAGGGAGTAAG No data
Right 1109547150 13:63844270-63844292 ATAGGACCTCCATCACAGTGGGG No data
1109547132_1109547148 24 Left 1109547132 13:63844221-63844243 CCCCCCGCGAGGCAGGGAGTAAG No data
Right 1109547148 13:63844268-63844290 TCATAGGACCTCCATCACAGTGG No data
1109547132_1109547151 27 Left 1109547132 13:63844221-63844243 CCCCCCGCGAGGCAGGGAGTAAG No data
Right 1109547151 13:63844271-63844293 TAGGACCTCCATCACAGTGGGGG No data
1109547132_1109547137 0 Left 1109547132 13:63844221-63844243 CCCCCCGCGAGGCAGGGAGTAAG No data
Right 1109547137 13:63844244-63844266 AGCCAGCCCCTCATCCCCCCTGG No data
1109547132_1109547149 25 Left 1109547132 13:63844221-63844243 CCCCCCGCGAGGCAGGGAGTAAG No data
Right 1109547149 13:63844269-63844291 CATAGGACCTCCATCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109547132 Original CRISPR CTTACTCCCTGCCTCGCGGG GGG (reversed) Intergenic
No off target data available for this crispr