ID: 1109547138

View in Genome Browser
Species Human (GRCh38)
Location 13:63844246-63844268
Sequence AGCCAGGGGGGATGAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109547138_1109547151 2 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547151 13:63844271-63844293 TAGGACCTCCATCACAGTGGGGG No data
1109547138_1109547153 6 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547138_1109547152 3 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547152 13:63844272-63844294 AGGACCTCCATCACAGTGGGGGG No data
1109547138_1109547148 -1 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547148 13:63844268-63844290 TCATAGGACCTCCATCACAGTGG No data
1109547138_1109547156 25 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547138_1109547149 0 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547149 13:63844269-63844291 CATAGGACCTCCATCACAGTGGG No data
1109547138_1109547150 1 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547150 13:63844270-63844292 ATAGGACCTCCATCACAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109547138 Original CRISPR AGCCAGGGGGGATGAGGGGC TGG (reversed) Intergenic
No off target data available for this crispr