ID: 1109547143

View in Genome Browser
Species Human (GRCh38)
Location 13:63844258-63844280
Sequence GGAGGTCCTATGAGCCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109547143_1109547151 -10 Left 1109547143 13:63844258-63844280 CCCCCCTGGCTCATAGGACCTCC No data
Right 1109547151 13:63844271-63844293 TAGGACCTCCATCACAGTGGGGG No data
1109547143_1109547153 -6 Left 1109547143 13:63844258-63844280 CCCCCCTGGCTCATAGGACCTCC No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547143_1109547156 13 Left 1109547143 13:63844258-63844280 CCCCCCTGGCTCATAGGACCTCC No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547143_1109547152 -9 Left 1109547143 13:63844258-63844280 CCCCCCTGGCTCATAGGACCTCC No data
Right 1109547152 13:63844272-63844294 AGGACCTCCATCACAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109547143 Original CRISPR GGAGGTCCTATGAGCCAGGG GGG (reversed) Intergenic
No off target data available for this crispr