ID: 1109547153

View in Genome Browser
Species Human (GRCh38)
Location 13:63844275-63844297
Sequence ACCTCCATCACAGTGGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109547147_1109547153 -10 Left 1109547147 13:63844262-63844284 CCTGGCTCATAGGACCTCCATCA No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547139_1109547153 2 Left 1109547139 13:63844250-63844272 CCCCTCATCCCCCCTGGCTCATA No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547140_1109547153 1 Left 1109547140 13:63844251-63844273 CCCTCATCCCCCCTGGCTCATAG No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547143_1109547153 -6 Left 1109547143 13:63844258-63844280 CCCCCCTGGCTCATAGGACCTCC No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547135_1109547153 28 Left 1109547135 13:63844224-63844246 CCCGCGAGGCAGGGAGTAAGAGC No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547133_1109547153 30 Left 1109547133 13:63844222-63844244 CCCCCGCGAGGCAGGGAGTAAGA No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547141_1109547153 0 Left 1109547141 13:63844252-63844274 CCTCATCCCCCCTGGCTCATAGG No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547134_1109547153 29 Left 1109547134 13:63844223-63844245 CCCCGCGAGGCAGGGAGTAAGAG No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547145_1109547153 -8 Left 1109547145 13:63844260-63844282 CCCCTGGCTCATAGGACCTCCAT No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547136_1109547153 27 Left 1109547136 13:63844225-63844247 CCGCGAGGCAGGGAGTAAGAGCC No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547146_1109547153 -9 Left 1109547146 13:63844261-63844283 CCCTGGCTCATAGGACCTCCATC No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547144_1109547153 -7 Left 1109547144 13:63844259-63844281 CCCCCTGGCTCATAGGACCTCCA No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data
1109547138_1109547153 6 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547153 13:63844275-63844297 ACCTCCATCACAGTGGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109547153 Original CRISPR ACCTCCATCACAGTGGGGGG AGG Intergenic
No off target data available for this crispr