ID: 1109547156

View in Genome Browser
Species Human (GRCh38)
Location 13:63844294-63844316
Sequence GAGGCAGCCGCCGCGCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109547138_1109547156 25 Left 1109547138 13:63844246-63844268 CCAGCCCCTCATCCCCCCTGGCT No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547155_1109547156 -8 Left 1109547155 13:63844279-63844301 CCATCACAGTGGGGGGAGGCAGC No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547143_1109547156 13 Left 1109547143 13:63844258-63844280 CCCCCCTGGCTCATAGGACCTCC No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547140_1109547156 20 Left 1109547140 13:63844251-63844273 CCCTCATCCCCCCTGGCTCATAG No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547145_1109547156 11 Left 1109547145 13:63844260-63844282 CCCCTGGCTCATAGGACCTCCAT No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547139_1109547156 21 Left 1109547139 13:63844250-63844272 CCCCTCATCCCCCCTGGCTCATA No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547146_1109547156 10 Left 1109547146 13:63844261-63844283 CCCTGGCTCATAGGACCTCCATC No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547141_1109547156 19 Left 1109547141 13:63844252-63844274 CCTCATCCCCCCTGGCTCATAGG No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547147_1109547156 9 Left 1109547147 13:63844262-63844284 CCTGGCTCATAGGACCTCCATCA No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547144_1109547156 12 Left 1109547144 13:63844259-63844281 CCCCCTGGCTCATAGGACCTCCA No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data
1109547154_1109547156 -5 Left 1109547154 13:63844276-63844298 CCTCCATCACAGTGGGGGGAGGC No data
Right 1109547156 13:63844294-63844316 GAGGCAGCCGCCGCGCGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109547156 Original CRISPR GAGGCAGCCGCCGCGCGCCG AGG Intergenic
No off target data available for this crispr