ID: 1109548521

View in Genome Browser
Species Human (GRCh38)
Location 13:63860694-63860716
Sequence AAAGTGGTCCATATTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109548521_1109548523 -9 Left 1109548521 13:63860694-63860716 CCAAAATCAATATGGACCACTTT No data
Right 1109548523 13:63860708-63860730 GACCACTTTTGACAGCCAGAGGG No data
1109548521_1109548522 -10 Left 1109548521 13:63860694-63860716 CCAAAATCAATATGGACCACTTT No data
Right 1109548522 13:63860707-63860729 GGACCACTTTTGACAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109548521 Original CRISPR AAAGTGGTCCATATTGATTT TGG (reversed) Intergenic
No off target data available for this crispr