ID: 1109555997

View in Genome Browser
Species Human (GRCh38)
Location 13:63976419-63976441
Sequence CTTCCAACTTAGTTGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109555997_1109556008 30 Left 1109555997 13:63976419-63976441 CCATGTTCCAACTAAGTTGGAAG 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1109556008 13:63976472-63976494 AGAAGACTATGTAGTATAGGGGG No data
1109555997_1109556007 29 Left 1109555997 13:63976419-63976441 CCATGTTCCAACTAAGTTGGAAG 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1109556007 13:63976471-63976493 TAGAAGACTATGTAGTATAGGGG No data
1109555997_1109556006 28 Left 1109555997 13:63976419-63976441 CCATGTTCCAACTAAGTTGGAAG 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1109556006 13:63976470-63976492 CTAGAAGACTATGTAGTATAGGG No data
1109555997_1109556005 27 Left 1109555997 13:63976419-63976441 CCATGTTCCAACTAAGTTGGAAG 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1109556005 13:63976469-63976491 CCTAGAAGACTATGTAGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109555997 Original CRISPR CTTCCAACTTAGTTGGAACA TGG (reversed) Intergenic
900913439 1:5618121-5618143 CTTCCTACTTAGATGGCACCAGG - Intergenic
903035227 1:20488548-20488570 CTTTAACCTTATTTGGAACAAGG - Intergenic
904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG + Intronic
907891636 1:58642116-58642138 ATTCTAACTTACTTGGAACATGG - Intergenic
908196903 1:61754208-61754230 ATTTCAACTTTGTTGAAACACGG - Intronic
910575672 1:88760560-88760582 TTTCCAGCTGAGTTCGAACAAGG + Intronic
917404540 1:174690599-174690621 CATTCAAATTAGTTGGACCAGGG - Intronic
918347699 1:183620115-183620137 CTTCAAACTTAGTGGTAACATGG + Intergenic
920343017 1:205287453-205287475 CTTCCACCTAAGAGGGAACAGGG - Intergenic
920867626 1:209766536-209766558 ATTCCACCTGAGGTGGAACAGGG + Intronic
921311374 1:213847214-213847236 CATCCCACTTAGTAGGCACATGG + Intergenic
1065194830 10:23253933-23253955 CTTTCAACTTTGCTGCAACATGG + Intergenic
1066471947 10:35707559-35707581 CTTCCAGCTTAGCTGAAGCATGG + Intergenic
1072132262 10:92506309-92506331 CTTTCAACTTTGTAGCAACAGGG - Intronic
1073820926 10:107263597-107263619 CTTCCAACGTACTTTGAGCAAGG - Intergenic
1074490212 10:113933186-113933208 CTGTCCACTTAGTTGGGACAGGG + Intergenic
1076451204 10:130558119-130558141 CCCCCAACTTACTTGGAGCAGGG - Intergenic
1076934967 10:133561852-133561874 GTTCCAAATTATGTGGAACAAGG + Intronic
1080320298 11:31000758-31000780 CTTCCTAAGTAATTGGAACATGG - Intronic
1084562836 11:69913972-69913994 CTCCCACCTAAGTGGGAACATGG + Intergenic
1085249048 11:75129708-75129730 CTTCCAACTGGGCAGGAACATGG + Intronic
1085552737 11:77390114-77390136 CTGCCAACTTCCTTGGTACAAGG - Intronic
1085942335 11:81220138-81220160 ATTCCAATTTAGTTTGCACAGGG + Intergenic
1085958137 11:81426465-81426487 CTTTCTACTGAGTGGGAACAAGG + Intergenic
1087840396 11:102914785-102914807 CTCCCAGAATAGTTGGAACATGG - Intergenic
1090903251 11:131050975-131050997 TTCCCAACTGAGGTGGAACAAGG + Intergenic
1091138058 11:133210611-133210633 ATTTCAACTTTGATGGAACAGGG - Intronic
1091602973 12:1929176-1929198 CTTCCAACACAGTGGCAACAAGG + Intergenic
1094410232 12:30160498-30160520 CTTACAAATTTGGTGGAACATGG + Intergenic
1094800497 12:34028050-34028072 ATACAAACTTACTTGGAACATGG - Exonic
1095113293 12:38322336-38322358 ATACAAACTTACTTGGAACATGG - Exonic
1100389398 12:94134883-94134905 TTTCAAACTTTGTTTGAACATGG - Intergenic
1103550711 12:121735227-121735249 CTCCCAACTTAGTGAAAACAAGG + Intronic
1104154032 12:126113497-126113519 TTTTCACCTTAGATGGAACAAGG + Intergenic
1108029421 13:46213424-46213446 CCTCCAGCTGAGGTGGAACAAGG + Intronic
1109555997 13:63976419-63976441 CTTCCAACTTAGTTGGAACATGG - Intergenic
1109999122 13:70171206-70171228 CTTCAAACTGTGTTGGAAGAAGG - Intergenic
1110145070 13:72180602-72180624 CTTCCTTCTTATTTTGAACAAGG + Intergenic
1111598334 13:90439227-90439249 CTTCAAATTTATTTGGAAGATGG - Intergenic
1112919852 13:104598687-104598709 ATTCCAACTAAGTTGAAATATGG - Intergenic
1118059024 14:62115710-62115732 CTTCCTTCTTCGTTGGAATAAGG - Intergenic
1118686380 14:68295536-68295558 CTCCTATCTTAGCTGGAACAAGG - Intronic
1123980068 15:25593739-25593761 ATCCCAACTGAGGTGGAACAAGG + Intergenic
1125895718 15:43300303-43300325 CTTCCTACTTATCTGTAACAGGG - Intronic
1127080759 15:55377057-55377079 CTTCTAACTTAGGTGGCTCAAGG + Exonic
1127148555 15:56050398-56050420 CAGCCAACTGAGATGGAACACGG - Intergenic
1128273963 15:66336663-66336685 CTCCCAACTTAGTGAAAACAAGG + Exonic
1132626918 16:895586-895608 ATTCCAACGTGTTTGGAACATGG + Intronic
1133234084 16:4379647-4379669 CTTCCCACTTCGCTGGCACATGG + Intronic
1138606232 16:58091109-58091131 CCTCCAACTTAGTGAAAACAAGG + Intergenic
1140593915 16:76386039-76386061 CTTCCAACTGAGTTCAAACAAGG - Intronic
1143924431 17:10357309-10357331 CTTCCAACTCAGTAGGGACTGGG - Intronic
1145287074 17:21513788-21513810 CTTCCAACTTAGGACCAACAGGG + Intergenic
1156555837 18:38067283-38067305 TTTTCAACTTAGTTGGAATCAGG + Intergenic
928029655 2:27767677-27767699 CTCCCAACTAAGTGGGAAAATGG + Intergenic
928325826 2:30318705-30318727 CTTCCCACTTCATGGGAACATGG - Intronic
929135122 2:38616512-38616534 CATCCAACAGATTTGGAACAAGG + Intergenic
944037794 2:195317213-195317235 CTTTCAAGTTCTTTGGAACAAGG - Intergenic
1169318046 20:4609387-4609409 CTTCAAACTTTCTTTGAACAGGG - Intergenic
1169995706 20:11553829-11553851 TTTCCAACTAAGTTGGAAACTGG - Intergenic
1172831253 20:37837057-37837079 CTTCCAACTTGGTTGGCACAAGG + Intronic
1178196419 21:30349762-30349784 CTCCCAACTGAGTTGGCAAAAGG - Intronic
1179803016 21:43820454-43820476 ATTCCACCTTATTTGGAATAAGG + Intergenic
1183177136 22:36232628-36232650 CTTCCAACTTAAATGGACCCCGG - Intronic
952077844 3:29719873-29719895 CTTCCCACCTAATTGGAACTCGG + Intronic
954842528 3:53524544-53524566 CTTTTAAGTTAGTAGGAACAGGG + Intronic
957038436 3:75316564-75316586 CTTCCTACATAGTTGTGACATGG - Intergenic
960470007 3:118051431-118051453 CTTCCAACTTAATAAGAAGATGG - Intergenic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
961404390 3:126668041-126668063 CACCCAACTCAGTGGGAACAGGG + Intergenic
966890840 3:184406452-184406474 GTGACAACTTAGTTGGCACAAGG + Intronic
967214310 3:187197574-187197596 TTTCCACCTTAGTGAGAACACGG - Exonic
970708730 4:18836686-18836708 CTTCCACCTTAGCTGAAGCATGG + Intergenic
972120269 4:35693192-35693214 CTGACAACTTATTTGGGACAGGG + Intergenic
974507357 4:62793408-62793430 CTTACAGCTTACTTTGAACAAGG - Intergenic
976019974 4:80610809-80610831 CCTCCAACTTAGTTGTAGGAGGG + Intronic
980588124 4:134846793-134846815 CTGCCAACTTTGTTGTAAAATGG - Intergenic
981660982 4:147166322-147166344 TTTCCAACTAGGTTGGAAGAGGG - Intergenic
986559574 5:9046942-9046964 CTTCCAGCTTAGTTGGTCAATGG + Intronic
990323409 5:54651307-54651329 TTCCCAACTAAGTTGGAGCATGG - Intergenic
992950078 5:81850135-81850157 CTCCCAGCTTGGTTGGCACAAGG - Intergenic
993862212 5:93149817-93149839 CTTCCAACTTGGTTGTAAGTAGG - Intergenic
997180988 5:131828773-131828795 CTTCCAACTTAATTACATCAAGG - Intronic
998597044 5:143542643-143542665 CTTTCAACTTAATTGGACCCTGG + Intergenic
1007145350 6:39624211-39624233 CTTACCATTTAGTTGGAAAATGG - Intronic
1010648268 6:78420573-78420595 CTTTCAACATAGTTTGTACAAGG - Intergenic
1012276490 6:97281322-97281344 CTTCAAAATTAGTTGGTAAAGGG + Exonic
1014308091 6:119766954-119766976 CTTGTAACTTATTTGAAACAGGG + Intergenic
1017990714 6:159486760-159486782 CTTCTAACTTAATTCCAACATGG - Intergenic
1020759522 7:12251130-12251152 CTTCCAACTAAAGTGGAAAAAGG + Intergenic
1021802069 7:24316939-24316961 CTTCCAACTCAGATGGTTCAAGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025046758 7:55698938-55698960 CTTCCACATTGCTTGGAACAGGG - Intergenic
1025783569 7:64623338-64623360 CTTCCAAGTTAGGTGTAACCTGG + Intergenic
1028105141 7:86868083-86868105 CTTCCAACTAACTTGCATCAGGG + Intergenic
1031363488 7:120875211-120875233 CTTCCAACTTGTTTGCAACATGG + Intergenic
1031971912 7:128070931-128070953 TTTCCATTTTAGGTGGAACAGGG + Intronic
1033109420 7:138561385-138561407 CTCCCAACTGATTTGGAACCAGG - Intronic
1033230286 7:139592093-139592115 CTTTCAACTTAGTATAAACAAGG + Intronic
1033792971 7:144814729-144814751 CTTCTAATTTAGATGGTACATGG - Intronic
1036451064 8:8867985-8868007 CTTCCAACTGAGTGGGGCCATGG - Intronic
1038818670 8:30932224-30932246 CTTCCAACTAACTTGCATCAGGG - Intergenic
1043127021 8:76411286-76411308 CTTTAAAGTTAGTTGCAACAGGG + Intergenic
1044388940 8:91625882-91625904 CTGTCAACTTAGTTGGCATATGG + Intergenic
1044527599 8:93269171-93269193 CTTCCAAGCTAGTTTTAACAGGG - Intergenic
1047185148 8:122626420-122626442 CTTACAAGTTGGTTGCAACATGG - Intergenic
1057425738 9:94947947-94947969 CTTCCAACATAGTAAGCACAAGG - Intronic
1060967014 9:127717138-127717160 CTTCCACCTCAGTGGGAACGAGG + Intronic
1189341808 X:40210229-40210251 CTTCCAGCTTGTTTGGAACAAGG - Intergenic