ID: 1109567553

View in Genome Browser
Species Human (GRCh38)
Location 13:64137193-64137215
Sequence TTGTGTGAATGCAGTGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109567551_1109567553 7 Left 1109567551 13:64137163-64137185 CCATAATAAAAAAAAAAAAATAG No data
Right 1109567553 13:64137193-64137215 TTGTGTGAATGCAGTGAAAAGGG No data
1109567549_1109567553 27 Left 1109567549 13:64137143-64137165 CCTTACTCCTGCAAGAATGGCCA 0: 835
1: 1117
2: 909
3: 572
4: 502
Right 1109567553 13:64137193-64137215 TTGTGTGAATGCAGTGAAAAGGG No data
1109567550_1109567553 20 Left 1109567550 13:64137150-64137172 CCTGCAAGAATGGCCATAATAAA 0: 231
1: 1059
2: 1209
3: 956
4: 2076
Right 1109567553 13:64137193-64137215 TTGTGTGAATGCAGTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109567553 Original CRISPR TTGTGTGAATGCAGTGAAAA GGG Intergenic
No off target data available for this crispr