ID: 1109568198

View in Genome Browser
Species Human (GRCh38)
Location 13:64147923-64147945
Sequence ATGTTGTAACCGAAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109568197_1109568198 4 Left 1109568197 13:64147896-64147918 CCTAGTCAACACGTATATTTCTT No data
Right 1109568198 13:64147923-64147945 ATGTTGTAACCGAAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109568198 Original CRISPR ATGTTGTAACCGAAAGAAGA AGG Intergenic
No off target data available for this crispr