ID: 1109569011

View in Genome Browser
Species Human (GRCh38)
Location 13:64161780-64161802
Sequence CTATTTATGTAGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109569011_1109569016 9 Left 1109569011 13:64161780-64161802 CCCTTCACCTTCTACATAAATAG No data
Right 1109569016 13:64161812-64161834 CCAATTTTGAAAGCCAGTCTAGG No data
1109569011_1109569017 10 Left 1109569011 13:64161780-64161802 CCCTTCACCTTCTACATAAATAG No data
Right 1109569017 13:64161813-64161835 CAATTTTGAAAGCCAGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109569011 Original CRISPR CTATTTATGTAGAAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr