ID: 1109569280

View in Genome Browser
Species Human (GRCh38)
Location 13:64164700-64164722
Sequence GGTACTGATGGGTGCACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109569268_1109569280 21 Left 1109569268 13:64164656-64164678 CCTTGTGCACATTCACACTGGTA No data
Right 1109569280 13:64164700-64164722 GGTACTGATGGGTGCACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109569280 Original CRISPR GGTACTGATGGGTGCACGGC TGG Intergenic
No off target data available for this crispr