ID: 1109569820

View in Genome Browser
Species Human (GRCh38)
Location 13:64173084-64173106
Sequence TCATCTCTCCGGTTGATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109569820_1109569826 12 Left 1109569820 13:64173084-64173106 CCCAGAATCAACCGGAGAGATGA No data
Right 1109569826 13:64173119-64173141 TAGAGAAAATGTGAAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109569820 Original CRISPR TCATCTCTCCGGTTGATTCT GGG (reversed) Intergenic