ID: 1109579652

View in Genome Browser
Species Human (GRCh38)
Location 13:64311400-64311422
Sequence GATCTACTAAAGCTGAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109579652_1109579655 7 Left 1109579652 13:64311400-64311422 CCTATGTTCAGCTTTAGTAGATC No data
Right 1109579655 13:64311430-64311452 AAAGAATTTTTCCAAACTGGTGG No data
1109579652_1109579653 4 Left 1109579652 13:64311400-64311422 CCTATGTTCAGCTTTAGTAGATC No data
Right 1109579653 13:64311427-64311449 GCCAAAGAATTTTTCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109579652 Original CRISPR GATCTACTAAAGCTGAACAT AGG (reversed) Intergenic
No off target data available for this crispr