ID: 1109580381

View in Genome Browser
Species Human (GRCh38)
Location 13:64323739-64323761
Sequence CTGAAACATATGTAAACCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109580381_1109580383 -1 Left 1109580381 13:64323739-64323761 CCCTAGGTTTACATATGTTTCAG No data
Right 1109580383 13:64323761-64323783 GTTTTGTACAAGTACCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109580381 Original CRISPR CTGAAACATATGTAAACCTA GGG (reversed) Intergenic
No off target data available for this crispr