ID: 1109582290

View in Genome Browser
Species Human (GRCh38)
Location 13:64357052-64357074
Sequence ATTTATGTTTTTTCACCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109582289_1109582290 -7 Left 1109582289 13:64357036-64357058 CCAGTAAAAAGAAGTAATTTATG No data
Right 1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG No data
1109582288_1109582290 -4 Left 1109582288 13:64357033-64357055 CCTCCAGTAAAAAGAAGTAATTT No data
Right 1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG No data
1109582287_1109582290 14 Left 1109582287 13:64357015-64357037 CCTTGGAGATATGCAAGTCCTCC No data
Right 1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG No data
1109582286_1109582290 22 Left 1109582286 13:64357007-64357029 CCTCTAAACCTTGGAGATATGCA No data
Right 1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109582290 Original CRISPR ATTTATGTTTTTTCACCTCA TGG Intergenic
No off target data available for this crispr