ID: 1109589806

View in Genome Browser
Species Human (GRCh38)
Location 13:64463182-64463204
Sequence GGGAGCAGACAGATGGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109589806_1109589817 9 Left 1109589806 13:64463182-64463204 CCCCTGTCCATCTGTCTGCTCCC No data
Right 1109589817 13:64463214-64463236 AGGAGTTTGAGCAGTGGCGGAGG No data
1109589806_1109589815 3 Left 1109589806 13:64463182-64463204 CCCCTGTCCATCTGTCTGCTCCC No data
Right 1109589815 13:64463208-64463230 CCTGTGAGGAGTTTGAGCAGTGG No data
1109589806_1109589816 6 Left 1109589806 13:64463182-64463204 CCCCTGTCCATCTGTCTGCTCCC No data
Right 1109589816 13:64463211-64463233 GTGAGGAGTTTGAGCAGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109589806 Original CRISPR GGGAGCAGACAGATGGACAG GGG (reversed) Intergenic
No off target data available for this crispr