ID: 1109610684

View in Genome Browser
Species Human (GRCh38)
Location 13:64761362-64761384
Sequence CAAAACAAAGACAAGAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109610680_1109610684 -5 Left 1109610680 13:64761344-64761366 CCCAAAGGCTGAGCTGTCCAAAA No data
Right 1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG No data
1109610681_1109610684 -6 Left 1109610681 13:64761345-64761367 CCAAAGGCTGAGCTGTCCAAAAC No data
Right 1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109610684 Original CRISPR CAAAACAAAGACAAGAGGTC TGG Intergenic
No off target data available for this crispr