ID: 1109611013

View in Genome Browser
Species Human (GRCh38)
Location 13:64764595-64764617
Sequence CTGCATGTATTGAGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109611013_1109611017 -4 Left 1109611013 13:64764595-64764617 CCCTCTGCTCTCAATACATGCAG No data
Right 1109611017 13:64764614-64764636 GCAGTAATGTGGGAGACTGATGG No data
1109611013_1109611018 -3 Left 1109611013 13:64764595-64764617 CCCTCTGCTCTCAATACATGCAG No data
Right 1109611018 13:64764615-64764637 CAGTAATGTGGGAGACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109611013 Original CRISPR CTGCATGTATTGAGAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr