ID: 1109622333

View in Genome Browser
Species Human (GRCh38)
Location 13:64925922-64925944
Sequence GCTCGGAGCTTCCGCCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109622333_1109622337 -2 Left 1109622333 13:64925922-64925944 CCAGAGTGGCGGAAGCTCCGAGC No data
Right 1109622337 13:64925943-64925965 GCCTGGGAGCAAGTCCTGCCCGG No data
1109622333_1109622343 27 Left 1109622333 13:64925922-64925944 CCAGAGTGGCGGAAGCTCCGAGC No data
Right 1109622343 13:64925972-64925994 AAGAGCGAGGACAGCACAGTCGG No data
1109622333_1109622340 14 Left 1109622333 13:64925922-64925944 CCAGAGTGGCGGAAGCTCCGAGC No data
Right 1109622340 13:64925959-64925981 TGCCCGGCTGTGCAAGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109622333 Original CRISPR GCTCGGAGCTTCCGCCACTC TGG (reversed) Intergenic
No off target data available for this crispr