ID: 1109623468

View in Genome Browser
Species Human (GRCh38)
Location 13:64941802-64941824
Sequence TTGCTGTTGTTGTTGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6733
Summary {0: 8, 1: 211, 2: 430, 3: 1079, 4: 5005}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109623468_1109623471 -5 Left 1109623468 13:64941802-64941824 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1109623471 13:64941820-64941842 AGCAAAAAACAAAACCAGGTCGG No data
1109623468_1109623472 -4 Left 1109623468 13:64941802-64941824 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1109623472 13:64941821-64941843 GCAAAAAACAAAACCAGGTCGGG No data
1109623468_1109623470 -9 Left 1109623468 13:64941802-64941824 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1109623470 13:64941816-64941838 CAACAGCAAAAAACAAAACCAGG No data
1109623468_1109623474 4 Left 1109623468 13:64941802-64941824 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1109623474 13:64941829-64941851 CAAAACCAGGTCGGGCGCGGTGG No data
1109623468_1109623473 1 Left 1109623468 13:64941802-64941824 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1109623473 13:64941826-64941848 AAACAAAACCAGGTCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109623468 Original CRISPR TTGCTGTTGTTGTTGAGACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr