ID: 1109628629

View in Genome Browser
Species Human (GRCh38)
Location 13:65013548-65013570
Sequence CCATCTGTACTAAAAATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 2, 1: 30, 2: 69, 3: 113, 4: 359}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109628629_1109628633 -7 Left 1109628629 13:65013548-65013570 CCTTGTATTTTTAGTACAGATGG 0: 2
1: 30
2: 69
3: 113
4: 359
Right 1109628633 13:65013564-65013586 CAGATGGGGTTTCACCATATTGG 0: 100
1: 6010
2: 56266
3: 110480
4: 133639
1109628629_1109628634 -2 Left 1109628629 13:65013548-65013570 CCTTGTATTTTTAGTACAGATGG 0: 2
1: 30
2: 69
3: 113
4: 359
Right 1109628634 13:65013569-65013591 GGGGTTTCACCATATTGGCCAGG 0: 6842
1: 83425
2: 161968
3: 196973
4: 150454
1109628629_1109628637 23 Left 1109628629 13:65013548-65013570 CCTTGTATTTTTAGTACAGATGG 0: 2
1: 30
2: 69
3: 113
4: 359
Right 1109628637 13:65013594-65013616 GATCTCGAACTCCTGACTTCAGG 0: 60
1: 3316
2: 42148
3: 93150
4: 68952

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109628629 Original CRISPR CCATCTGTACTAAAAATACA AGG (reversed) Intergenic
901383786 1:8893165-8893187 CCGTCTCTACTAAAAATACACGG + Intergenic
901403248 1:9028878-9028900 CCATCTCTATTGAAAATACATGG - Intergenic
902415206 1:16234546-16234568 CCATCCGTATTAAAAATAGAAGG - Intronic
902593543 1:17492238-17492260 CCGTCTCTGCTAAAAATATAAGG + Intergenic
903099726 1:21018397-21018419 CAGTCTCTACTAAAAATACAGGG + Intronic
904119459 1:28187651-28187673 CCACCTTTACAAAAAATACACGG - Intronic
904140470 1:28349027-28349049 CCATCTGTACAAAAAAAAAAAGG + Intergenic
905122066 1:35690012-35690034 CCGTCTCTACAAAAAATACCTGG - Intergenic
907007165 1:50926703-50926725 ACATGTAAACTAAAAATACAAGG + Intronic
907037197 1:51226939-51226961 CCATCTCTACTAAAAATACAAGG + Intergenic
907441710 1:54482729-54482751 CTGTCTCTACTAAAAGTACAAGG - Intergenic
907729501 1:57052237-57052259 CCATATGTACTAAGAATATAAGG - Intronic
907773836 1:57493070-57493092 CCATCTGTACTAACAGCCCATGG - Intronic
907824320 1:58000739-58000761 CCGACCCTACTAAAAATACAAGG - Intronic
908415388 1:63908604-63908626 CCATCTTTACTAACAAAACATGG + Intronic
909011378 1:70339048-70339070 CCGTCTCTACTAAAAATAGCCGG + Intronic
909837511 1:80275796-80275818 CAATCTGTTGTAAAAATCCAGGG + Intergenic
910265822 1:85336146-85336168 CCAAATGTACCAAAAATATATGG + Intronic
911292724 1:96077560-96077582 CCATCTCTACTAAAAATACAAGG - Intergenic
911454217 1:98103099-98103121 TCATCTCTACTATAAATACATGG - Intergenic
912265048 1:108149033-108149055 CCAGGTGTACAGAAAATACAAGG + Intronic
912739440 1:112180167-112180189 CCATCTTTCCTGAAAATACCTGG + Intergenic
914729939 1:150361352-150361374 CCATCTCTACTAAAAATACAGGG - Intergenic
914796599 1:150925282-150925304 CCATCTCGACTAAAAATACAAGG - Intergenic
915174340 1:154002460-154002482 CCATCTCTACTAAAAATACGAGG + Intronic
915961558 1:160271243-160271265 CCATCTCTACAAAAAATTTAAGG - Intergenic
916709102 1:167386354-167386376 CCATCTCTACAAAAAATAGCTGG - Intronic
917014968 1:170519849-170519871 CCATCTCTACTAAAATTAGCCGG - Intergenic
917296198 1:173522024-173522046 CCGTCTCTACTAACAATACACGG + Intronic
918044663 1:180934704-180934726 CAATCACTACCAAAAATACATGG + Intronic
919910972 1:202110576-202110598 CCGTCTCTGCTAAAACTACAAGG - Intergenic
919941597 1:202290700-202290722 CCATCTCTACTAAAAATACAAGG + Intronic
920351440 1:205340643-205340665 CCGTCTCTACTAAAAATACCAGG - Intronic
920368354 1:205460538-205460560 CCGTCTCTACTCAAAATAAAAGG + Intergenic
920442603 1:205990941-205990963 CCGCCTCTACTAAAAATACGTGG - Intronic
921213556 1:212919479-212919501 CAATCTGTAATAAAAAGAAATGG + Intergenic
921571528 1:216785212-216785234 GCACTTGTAATAAAAATACAGGG - Intronic
921886117 1:220308142-220308164 CCATCTCTACTAAAAATACAAGG - Intergenic
922103122 1:222490411-222490433 CCATCTCTACTAAAATTAGCTGG + Intergenic
922266175 1:223986101-223986123 CCGTCTCTACTAAAAATACAAGG + Intergenic
924117032 1:240757971-240757993 CCGTCTCTACTAAAGGTACAAGG - Intergenic
924603206 1:245509693-245509715 TCATCTGCACTAAAGATACCTGG - Intronic
924761938 1:246995657-246995679 CCGTCTCTACTAAAAAGACACGG + Intronic
1062769850 10:90948-90970 CCATCTGTACCAAAAATACAAGG + Intergenic
1063132389 10:3189335-3189357 CCATCTCTACAAAAAATATCTGG - Intergenic
1063588212 10:7372086-7372108 CCATCTCTACTAAAATTAGCTGG - Intronic
1064041349 10:11967859-11967881 CCATATGTATTAAAAATATCTGG - Intronic
1064106546 10:12505234-12505256 CCATCTGTTCTTAACACACATGG - Intronic
1064480225 10:15733374-15733396 CCATCTCTACACAAAATAGAAGG + Intergenic
1064801094 10:19073083-19073105 CCATCTCTAATAAAAATATAAGG - Intronic
1064820036 10:19318759-19318781 ACATGTGTAATAAAAATATAAGG - Intronic
1065442598 10:25768555-25768577 CCATCTCTACAAAAAATTAATGG + Intergenic
1065711584 10:28523149-28523171 CCATCTCTACTAAAGATGCAAGG - Intergenic
1066583429 10:36905620-36905642 TGATCTTTAATAAAAATACAAGG - Intergenic
1066632605 10:37471552-37471574 CCATCTGCAGAAAAAACACAAGG + Intergenic
1067113717 10:43418970-43418992 CCATCTTTACTAACAATACAAGG - Intergenic
1068018616 10:51550404-51550426 TCATTTGTACTAAAATTATATGG - Intronic
1069009324 10:63353675-63353697 CCATCTCTACTAAAAATAACTGG - Intronic
1069502598 10:68967337-68967359 CCATCTCTACTAAAAATACGAGG - Intronic
1070072621 10:73104436-73104458 CTATCTCTACTAAAATTACAAGG - Intergenic
1070121220 10:73579119-73579141 CCATCTGTACTAAAAATACATGG - Intronic
1070270650 10:74951457-74951479 CCATCTCTACAAAGAATACAAGG - Intronic
1070560688 10:77564428-77564450 CCACCTGTAAAAAAAATACCTGG - Intronic
1072979354 10:100086851-100086873 CCATCTCTACAAAAAATCAAAGG + Intergenic
1073374736 10:103023380-103023402 CCATCTCTACTAAAAATAGAGGG + Intronic
1073384156 10:103109017-103109039 CCGTCTCAACTAAAAATACCAGG - Intronic
1073629293 10:105132191-105132213 CCACCTGTACATAAAATAGAAGG + Intronic
1074339845 10:112617633-112617655 ACACCTGTCCTGAAAATACAAGG - Intronic
1074414650 10:113256740-113256762 CCATCTGTATTAGAATTACCTGG - Intergenic
1074977206 10:118591267-118591289 CCATCTCTACAAAAAATAGCCGG - Exonic
1075058072 10:119234843-119234865 CTGTCTCTACTAAAAATACAAGG - Intronic
1075792862 10:125097957-125097979 CCATCTCTACTAAAAGTAGCTGG + Intronic
1076359525 10:129877318-129877340 CCATCTCTACTAAAAATACTGGG + Intronic
1076742198 10:132491742-132491764 CCGTCTCTACTAAAAACACAAGG - Intergenic
1076759247 10:132592575-132592597 CCATCTCTACTAAAAATAGCTGG - Intronic
1076985696 11:234585-234607 CCGTCTTTACTAAAAATACAAGG - Intronic
1077012110 11:383730-383752 CCATCTGAACTAGATACACAGGG - Intergenic
1078555779 11:12324984-12325006 CCATCTGGGATGAAAATACAAGG - Intronic
1078618154 11:12883839-12883861 CCGTCTCTACTAAAAATACATGG + Intronic
1078954649 11:16177905-16177927 CCAGTGGTACTAAAAATTCAGGG - Intronic
1079012889 11:16844164-16844186 CCTGCTGTACAAAAAATTCATGG + Intronic
1079552602 11:21719098-21719120 GCATCTGTACAAAATATAAATGG - Intergenic
1079893535 11:26089783-26089805 CAATCTGTACTTAAGTTACACGG + Intergenic
1080212835 11:29806968-29806990 CCATCTGAACCAAAAACCCATGG + Intergenic
1081932576 11:46882309-46882331 CCATCTCTACCAAAAAAAAAGGG + Intronic
1082043115 11:47703254-47703276 GCATCTTATCTAAAAATACAGGG - Intronic
1083097214 11:60263940-60263962 TCTTCTGAACTAATAATACAAGG - Intergenic
1083247574 11:61441358-61441380 CCGTCTCTACTAAAAATACTGGG + Intronic
1083456070 11:62779493-62779515 CCGTCTCTATTAAAAATATAAGG - Intronic
1085815867 11:79736562-79736584 GCATATGTACAAATAATACATGG - Intergenic
1086262848 11:84961335-84961357 CTATTTGTAGCAAAAATACATGG + Intronic
1086515965 11:87613658-87613680 CCTTCTCTACTAATAATGCAAGG - Intergenic
1086799192 11:91150506-91150528 CCATCTCTACTAAAAATACAAGG - Intergenic
1087763031 11:102122245-102122267 CGATCTCTACTAAAAATAGAAGG + Intronic
1088094655 11:106084783-106084805 CCGTCTCTACTAAAAATACCAGG - Intronic
1088478818 11:110272616-110272638 TGATCTGTAATAAAAATAAAAGG + Exonic
1089279648 11:117364666-117364688 CCATCTCTACAAAAAATAGCCGG - Intronic
1090243433 11:125199671-125199693 CCATCTCTACTAAAAATACAAGG + Intronic
1090327278 11:125900009-125900031 CCGTTTGTACTCAAAATACCGGG - Exonic
1090432389 11:126656879-126656901 CCGTCTCTACTAGGAATACAGGG + Intronic
1090529881 11:127579296-127579318 CCATCTCTACTAAAAATACTGGG + Intergenic
1091258321 11:134211475-134211497 CTGTCTTTACAAAAAATACAGGG + Intronic
1091951666 12:4597902-4597924 CCATCTCTACTAAAAATAGCCGG + Intronic
1092351512 12:7759814-7759836 CCATCTCTACTAAAAATACTAGG - Intergenic
1092885972 12:12924688-12924710 CCATCTCTACAAAAGATAAAAGG - Intergenic
1093472333 12:19515927-19515949 CTGTCTCTACAAAAAATACATGG + Intronic
1093523114 12:20073265-20073287 TCACCTCTACTAAAAATAGAAGG + Intergenic
1095934781 12:47666052-47666074 CCTCCTGTACTAAACATACATGG - Intronic
1096312578 12:50534532-50534554 CCATCTGTACAAAAATTAGCCGG - Intronic
1096373403 12:51087012-51087034 CCATCTCTACTAAAAATAGCTGG + Intergenic
1097044460 12:56177114-56177136 CCATCTCTACTAAAAAGACCAGG - Intronic
1097060454 12:56279464-56279486 CCGTCTCTATTAAAAACACAAGG + Intronic
1097781335 12:63708434-63708456 CTGTCTCTACTAAAAATACCTGG + Intergenic
1098491139 12:71080532-71080554 CCATCTGTAAGAAAACTAAAAGG - Intronic
1098720020 12:73884665-73884687 TTATCTGTACTAAAAACATATGG - Intergenic
1099787142 12:87280182-87280204 CTATCTTTACTAAAAGTTCAGGG - Intergenic
1100235507 12:92656807-92656829 GCTTCTGTAGTTAAAATACAGGG - Intergenic
1100952101 12:99862948-99862970 CCATCTGGTCTAGAAATACTGGG - Intronic
1101907974 12:108841971-108841993 CTGTCTCTACCAAAAATACAAGG + Intronic
1102264875 12:111474911-111474933 CCATCTCTATTAAAAATACAAGG + Intronic
1102291793 12:111706946-111706968 CTGTCTCTACTAAAAATTCAGGG - Intronic
1102673808 12:114642726-114642748 CCATCTCTACTAAAAAAGCCAGG + Intergenic
1103007474 12:117433026-117433048 CCATAAGTAATGAAAATACATGG + Intronic
1103414252 12:120733269-120733291 CCGTCTCTACTAAAAATACAAGG - Intronic
1103720597 12:122973262-122973284 CCGTTTCTACTAAAAATACAAGG + Intronic
1103770026 12:123314765-123314787 CCATCTCTACAAAAATTAGATGG - Intronic
1104938277 12:132379008-132379030 CCGTCTCTACTAAAAATACATGG + Intergenic
1105253452 13:18721985-18722007 CCATCTGTTCTAAGAATGCTGGG + Intergenic
1105567543 13:21565355-21565377 CTGTCTCTACTAAAAACACAAGG + Intronic
1107241835 13:38244789-38244811 CCATCTCTAATAAAAATAGCTGG + Intergenic
1107804308 13:44140116-44140138 CCACCTGTACTTTAAATAGAAGG - Intergenic
1107927169 13:45274298-45274320 TAATTTGTACTAAAAATAAAAGG - Intronic
1108191492 13:47944950-47944972 CTATCTCTACTAAAAATACAAGG + Intronic
1108805048 13:54144240-54144262 CCATCTCTACAAAAATTAGACGG + Intergenic
1109628629 13:65013548-65013570 CCATCTGTACTAAAAATACAAGG - Intergenic
1109677240 13:65693823-65693845 TCATCAGTACTAAAAATCGAAGG - Intergenic
1111379002 13:87421162-87421184 CCATCTGTACTGAATATGTACGG - Intergenic
1111438026 13:88238117-88238139 ACATCTGTTCTAAAAATTGAAGG - Intergenic
1111702412 13:91707450-91707472 CCATCTCTACAAAAAAAATAAGG + Intronic
1111848840 13:93546461-93546483 TCATTTGTACTGAAAATACCAGG - Intronic
1112714406 13:102167128-102167150 CAATCTCTACTAAAAATACAAGG + Intronic
1113080646 13:106516326-106516348 CCCTCTCTACTTAAAATGCAAGG + Intronic
1113629383 13:111871694-111871716 ACATCTGTACTGAAAAAACAAGG - Intergenic
1113663248 13:112121524-112121546 CTGTCTCTACTGAAAATACAAGG - Intergenic
1114129862 14:19778502-19778524 CCATCTGGTCAAAAACTACATGG + Intronic
1114475043 14:22988293-22988315 CCATCTCTACTAAAAAGAGCTGG - Intronic
1114697607 14:24642239-24642261 ACATGTAAACTAAAAATACAAGG - Intergenic
1115091875 14:29586793-29586815 CCATCTCTACTAAAAATACCAGG - Intronic
1115562810 14:34598551-34598573 CCATCTCTATTAAAAATAGTTGG - Intronic
1116442416 14:44968418-44968440 CCGTCTCTACTAAAAATACTGGG - Intronic
1117595135 14:57319667-57319689 CTATCTGTATTCACAATACAGGG + Intergenic
1117710556 14:58524875-58524897 CCATCTCTACTAAAAATAGCTGG - Intronic
1118273615 14:64365954-64365976 CCGTCTCTACTAAAAATACCTGG - Intergenic
1118784082 14:69031143-69031165 TCATCTCTACAAAAAATACAAGG + Intergenic
1119803795 14:77468876-77468898 CCATCTCTACTAAAATTACGTGG - Intronic
1120289921 14:82555161-82555183 ACATCTGTACGAAAAAAAAAAGG - Intergenic
1120531160 14:85633017-85633039 ACATCTGCATGAAAAATACATGG - Exonic
1120787383 14:88550082-88550104 CTGTCTCTACTAAAAATACAAGG - Intronic
1120983003 14:90307701-90307723 CCATCTCTACTAAAAATACAGGG + Intronic
1121062467 14:90926233-90926255 CTGTCTCTACTAAAAATGCATGG + Intronic
1121110482 14:91309431-91309453 CCCTCTATACAAAACATACAAGG + Intronic
1122053244 14:99074461-99074483 CCATCTCTACTAAAATTAGCCGG + Intergenic
1122678717 14:103439332-103439354 CCATATGTGGTAAAATTACACGG - Intronic
1122700710 14:103586737-103586759 CCGTCTCTACTAAAAATACTGGG - Intronic
1122705904 14:103621303-103621325 CCATCTCTACTAAAATTAGTAGG + Intronic
1123436631 15:20259323-20259345 CCCTCTCTACCAAAAATACATGG + Intergenic
1123691752 15:22843866-22843888 CCATCTCTACAAAACATACCTGG - Intronic
1124567042 15:30825790-30825812 CTATCTGTACTGAGAATGCAGGG - Intergenic
1127788043 15:62373312-62373334 CCATCTCTACTAAAATTAGCTGG + Intergenic
1128076984 15:64833312-64833334 CGGTCTCTGCTAAAAATACAAGG - Intergenic
1128204533 15:65839006-65839028 CCATCTCTACTAAAAATACAAGG - Intronic
1128536694 15:68496985-68497007 CCATCTCTATTAAAAATAGCTGG - Intergenic
1128999910 15:72323389-72323411 GCTTCTCTACTAAAAATACAAGG - Intronic
1129005325 15:72368099-72368121 CTACCTGTACTAAGAATAGATGG + Intronic
1129020265 15:72510570-72510592 CCATCTCTACTAAAAAAATTAGG + Intronic
1130204770 15:81865734-81865756 CCATCTCTACTAAAAATAGCAGG + Intergenic
1130290213 15:82592415-82592437 CCATCTCTACCAAAAATACAGGG + Intronic
1130375303 15:83323725-83323747 ACATCTGTGCTTAAACTACATGG + Intergenic
1131171582 15:90182844-90182866 CCGTCTCTACTGAAAATACATGG - Intronic
1131969171 15:97875177-97875199 CCATCTGTGCTGGGAATACAGGG + Intergenic
1132155129 15:99490622-99490644 CTGTCTCTACTGAAAATACAAGG - Intergenic
1132267122 15:100484000-100484022 CCACCTCTACTAAAAATCCTGGG + Intronic
1132387252 15:101409283-101409305 CTGTCTCTATTAAAAATACAAGG + Intronic
1133208367 16:4247938-4247960 CCATCTCTACTAAAAATACCAGG + Intergenic
1133241792 16:4418492-4418514 CCGTCTCTACTAAAAATACAAGG + Intronic
1133463891 16:6011070-6011092 CCATTTGTAATAAAAAGACTAGG + Intergenic
1134754948 16:16658774-16658796 CCATCTCTACTAAAGAGACTAGG + Intergenic
1134763812 16:16738129-16738151 CCATCTTTACTAAACAGACTAGG + Intergenic
1134982242 16:18621028-18621050 CCATCTTTACTAAACAGACTAGG - Intergenic
1134991115 16:18700375-18700397 CCATCTCTACTAAAGAGACTAGG - Intergenic
1136400212 16:30012843-30012865 CCATCTCTGCTAAAAATGCCGGG + Intronic
1136427238 16:30177067-30177089 CCGTCTCTACTAAAAAAATATGG + Intergenic
1136847938 16:33591532-33591554 CCCTCTCTATCAAAAATACATGG - Intergenic
1137656669 16:50165149-50165171 ACATATGTACTATGAATACAAGG - Intronic
1137672317 16:50286220-50286242 CCATCTCTACAAAAAATACATGG + Intronic
1138246320 16:55469485-55469507 ACATCTGTTCAATAAATACATGG - Intronic
1138996459 16:62459082-62459104 CCATGTCTACTAAAAAAAAAAGG - Intergenic
1139234719 16:65325583-65325605 CCGTCTCTACTAAAAATACCAGG - Intergenic
1139493118 16:67297794-67297816 CCATCTAAAAAAAAAATACAAGG - Intronic
1139555924 16:67710288-67710310 CGGTTTCTACTAAAAATACAGGG - Intronic
1139619510 16:68126052-68126074 CCATCTCTACTAAAATTAGCTGG - Intronic
1139704083 16:68728464-68728486 CCATCTCTATTGAAAATACAAGG - Intergenic
1140084442 16:71781540-71781562 CCATGTGTAGTAAGAATATATGG - Intronic
1140413134 16:74753506-74753528 CCGTCTCTACTAAAAATAGCTGG + Intronic
1140753231 16:78045330-78045352 CCATCTCTACTAAAAGTAGCGGG + Intronic
1141118890 16:81335444-81335466 CTGTGTCTACTAAAAATACATGG + Intronic
1203109646 16_KI270728v1_random:1440181-1440203 CCCTCTCTATCAAAAATACATGG - Intergenic
1142531945 17:585484-585506 GAATCTCTACTAAAAATAGAGGG + Intronic
1142724725 17:1804345-1804367 CTGTCTCTACTAAAAATACAGGG - Intronic
1142819286 17:2451973-2451995 CCATCTCTACAAAAAATAGCTGG + Intronic
1143169803 17:4922075-4922097 CTGTCTCTACTAAAAATTCAGGG + Intergenic
1143703476 17:8679881-8679903 CCATCTTTACTAAAAATTGGTGG - Intergenic
1144292149 17:13837221-13837243 CCGTCTCTACTAAAAATACAAGG - Intergenic
1144522436 17:15962686-15962708 CCGTCTCTACTAAAAATGCGTGG - Intronic
1144841133 17:18186601-18186623 ACTTCTGTTCTTAAAATACAGGG - Intronic
1144867432 17:18345545-18345567 CCGTCTCTACTAAAAATACATGG - Intronic
1145045588 17:19612608-19612630 TCATCTCTACTAAAAATAGCTGG + Intergenic
1145931992 17:28692460-28692482 CCATCTCTACTAAAAATATAAGG + Intronic
1146047879 17:29525564-29525586 CCTTCTCTACTAAAAACACGAGG - Intronic
1146050926 17:29552891-29552913 CCATCTCTACTAAAAATACATGG + Intergenic
1146070183 17:29673397-29673419 CCATCTCTACTAAAAATACAAGG + Intronic
1146228310 17:31087002-31087024 GCAACTCTACTAAAAATACACGG + Intergenic
1146593631 17:34150940-34150962 CCATCTCTACTAAAAATACCAGG + Intronic
1147181975 17:38692260-38692282 CCATCTCTACTAAAAATACGAGG - Intergenic
1147192294 17:38745040-38745062 CCATCTCTACTAAAAATACATGG + Intronic
1147231650 17:39023742-39023764 CCATCTCTACTAAAAATAGCCGG - Intergenic
1147273054 17:39290731-39290753 CCATCTCTACAAAAAATAAAAGG - Intronic
1147292099 17:39451718-39451740 CCGTCTCTACTAAAAATAGCTGG - Intergenic
1147397633 17:40157036-40157058 CCATCTGTTAAAAAAATAAAAGG + Intronic
1147932637 17:43992408-43992430 CCGTCTCTACTAAAAATACAAGG + Intronic
1147993518 17:44349412-44349434 CCATTTGTCCTAGAAAGACAGGG - Exonic
1148380809 17:47195527-47195549 CAGTCTCTACTAAAAATACTTGG - Intergenic
1148704821 17:49620305-49620327 CTGTCTCTACTAAAAATACCAGG + Intronic
1148823730 17:50376886-50376908 CAATCTCTACAAAAAACACAGGG - Intronic
1148916349 17:50982669-50982691 CCATCTTTAAAAAAAATAAAAGG + Exonic
1150353352 17:64462794-64462816 CTGTCTTTACTAAAAATACATGG - Intronic
1150372362 17:64651039-64651061 CTGTCTCTACTAAAAATACATGG + Intronic
1150379664 17:64710575-64710597 CCATCTAAAAAAAAAATACAAGG + Intergenic
1152402596 17:80076904-80076926 CTATTTCTACTAAAAATACCAGG - Intronic
1152881524 17:82818894-82818916 CCGTCTCTGCTAAAAATACAAGG + Intronic
1153031488 18:717560-717582 CCATCTGTACAAAAATTAGCTGG - Intergenic
1155824179 18:30418346-30418368 CAATCTGTATTAAAATTACCTGG - Intergenic
1156774729 18:40773011-40773033 CCATCTATACATATAATACAGGG - Intergenic
1156990924 18:43406564-43406586 CCATCTTTACTAAAAATACTGGG - Intergenic
1157230907 18:45915106-45915128 CTGACTCTACTAAAAATACAAGG + Intronic
1158528853 18:58240169-58240191 ACATCTGAAAAAAAAATACAAGG - Intronic
1158556043 18:58475489-58475511 CCATCTCTACCAAAAAAAGAAGG + Intergenic
1158584994 18:58724972-58724994 CCATCTCTACTAAAAATGTATGG + Intronic
1159577093 18:70192508-70192530 CCATCTCTACAAAAAATAAAAGG + Intronic
1160760265 19:780602-780624 CCATCTCTATTAAAAATAAAAGG - Intergenic
1160912392 19:1480924-1480946 CCATCTCTACTAAAAAAGGAAGG + Intergenic
1161277744 19:3428321-3428343 CCATCTGTACTAGGAGGACACGG + Intronic
1161413123 19:4128189-4128211 CTGTCTCTACTAAAAATACAAGG + Intergenic
1161533575 19:4804718-4804740 CCATCTCTACAAAAAATGTAGGG + Intergenic
1161533634 19:4805153-4805175 CCATCTTTACAAAAATTACCTGG + Intergenic
1161828351 19:6584857-6584879 TCACCTCTACTGAAAATACAGGG - Intronic
1162347794 19:10130609-10130631 CCATCTCTACTAAAATTAGCTGG + Intergenic
1162656926 19:12138280-12138302 CCATCTCTACTTAAAATACATGG + Intronic
1163108986 19:15146372-15146394 CCATCTCTACTAAAAATAGCCGG + Intergenic
1164284994 19:23806371-23806393 CCATCTTTACTAAGAATCCCAGG - Intronic
1164527591 19:29023219-29023241 CCATCTGTGCTAAGAAGCCAAGG + Intergenic
1165193843 19:34085863-34085885 CTGTCTCTACAAAAAATACAAGG - Intergenic
1165667906 19:37649659-37649681 CCATCTCTACAAAAAATTAACGG + Intronic
1165886353 19:39081828-39081850 CCGTCTCTACTAAAAATACAAGG + Intergenic
1166606957 19:44151863-44151885 TCAGCTGAACTAAAAATAGAAGG - Intronic
1166657279 19:44621476-44621498 CCATCTCTACAAAAAATAGCTGG + Intronic
1167136943 19:47622262-47622284 CCATCTCTACTAAAAAAGTATGG - Intronic
1167893084 19:52558244-52558266 CCGCCTCTACTAAAAATACAAGG - Intronic
926604492 2:14883797-14883819 CCATCTCTACAAAAAATACCTGG + Intergenic
926883126 2:17570872-17570894 CCAATTCTACTAAAAATACCAGG + Intronic
927127760 2:20028496-20028518 CTGTCTCTACTAAAAATACAAGG - Intergenic
927372039 2:22367372-22367394 CTATTTGTGCTAAAAATCCATGG - Intergenic
928602027 2:32913010-32913032 GCATCTGTACTGAAAATTAAGGG - Intergenic
929514437 2:42593806-42593828 CCATCTCTATAAAAAATAAATGG + Intronic
930347660 2:50205020-50205042 ATATCAGTACTATAAATACATGG + Intronic
930731244 2:54729963-54729985 CCATCTCTACAGAAAATACAAGG + Intronic
930759084 2:55012593-55012615 TAATCTCTACTAAAAATAGAAGG + Intronic
931739661 2:65230337-65230359 TCATATATACTACAAATACAGGG - Intronic
932489385 2:72110542-72110564 CCATCTATAATAAAAATACTTGG - Intergenic
934487787 2:94733084-94733106 CCATCTGTTCTAAGAATGCTGGG + Intergenic
935742410 2:106161274-106161296 TCATCTCTACAAGAAATACAAGG - Intronic
936814235 2:116440365-116440387 AAATCTGTACTAGAATTACATGG + Intergenic
937743288 2:125380965-125380987 TCATGTGAAATAAAAATACAGGG - Intergenic
937747704 2:125434540-125434562 CCATCTCTACAAAAAGTAAATGG + Intergenic
937881693 2:126871882-126871904 CCGTCTCTACTAAAAATAGACGG + Intergenic
938751449 2:134334650-134334672 CAATCTGGCCTAAGAATACAAGG + Intronic
939823122 2:146981303-146981325 CCGTCTCTACTAAAAATACAAGG + Intergenic
940510679 2:154610610-154610632 CCATCTTTACTAAAATTAGCTGG - Intergenic
941523221 2:166574880-166574902 CCATCTTTATTAAAAATATGGGG + Intergenic
942018692 2:171843955-171843977 CCATCTCTACTAAAATTAGCCGG - Intronic
942282376 2:174378532-174378554 ACCTCTGTACTAAAAAGAGATGG + Intronic
943280293 2:185923737-185923759 TCATCTCTACAAAAAATACATGG + Intergenic
944775448 2:202959646-202959668 CTGTCTCTACTAAAAATACCAGG + Intronic
944803968 2:203262848-203262870 CCATCTCTACTAAAAATAGCAGG - Intronic
945091415 2:206179499-206179521 CTGTCTCTACTAAAAATACCTGG - Intronic
945878018 2:215298103-215298125 ACATCTCTACTAAAAATAGCCGG + Intergenic
945918160 2:215726412-215726434 CCATCTATACTAGAAATGGAGGG + Intergenic
946666563 2:222055974-222055996 CCAACTGTACTTAAAAGATAAGG - Intergenic
946993309 2:225360514-225360536 CCAGCTGTACTATAAAGTCATGG - Intergenic
947158420 2:227187077-227187099 TCATGTGTACTAAAAATATCTGG - Intronic
1168952637 20:1812826-1812848 CCATCTCTACTAAAAATACAAGG + Intergenic
1169728471 20:8761762-8761784 CCGTCTCTACTAAAAATAGCGGG - Intronic
1169740925 20:8893480-8893502 CCATCTGTAAGTAACATACACGG + Intronic
1169842212 20:9951892-9951914 CCATCTCTACTAAAAATACAAGG + Intergenic
1169908723 20:10629660-10629682 GCAACTGAACTTAAAATACAAGG - Intronic
1170358010 20:15513285-15513307 CCAGCTGTACTTAGAAAACAGGG - Intronic
1170450331 20:16476917-16476939 CCATCTCTACTAAAAATACATGG - Intronic
1170565712 20:17602856-17602878 CCATCTCTACTAAAATTAACTGG + Intronic
1170634848 20:18095281-18095303 CTGTCTGTACTAAAAATACAAGG + Intergenic
1171458401 20:25284594-25284616 CTGTCTCTACAAAAAATACAAGG - Intronic
1172344505 20:34186982-34187004 CCGTCTCTAGTAAAAATACTAGG - Intergenic
1173995275 20:47333428-47333450 CCGTCTCTACTAAAAATACATGG + Intronic
1174063632 20:47849425-47849447 CCATCTCTACCAAAAATACATGG - Intergenic
1174427731 20:50444695-50444717 CCGTCTCTACTAAAAATACACGG + Intergenic
1174653074 20:52145480-52145502 CCATCTCTACAAAAAATATGTGG + Intronic
1175616799 20:60406786-60406808 CCATTTCTACTAAAAATAGCTGG + Intergenic
1176168025 20:63684641-63684663 CCATTTCTACTAAAAATATCAGG - Intronic
1177546323 21:22562919-22562941 CCGTCTCTACTAAAAATACAAGG - Intergenic
1178066487 21:28909645-28909667 GCAACTGTACTTAAAATACTAGG - Intergenic
1178542637 21:33467322-33467344 TCATCTCTTCTAAAAATACAAGG + Intronic
1178987254 21:37317114-37317136 TCATCTGTACAAAAATTAGACGG + Intergenic
1180781826 22:18524729-18524751 CTATCTCTACTGAAAATACAAGG + Intergenic
1181238712 22:21464072-21464094 CTATCTCTACTGAAAATACAAGG + Intergenic
1181940685 22:26473580-26473602 CCGTCTCTACTAAAAATACTGGG + Intronic
1182238599 22:28896432-28896454 CTGTCTCTACTAAAAATATAGGG - Intronic
1182597051 22:31429935-31429957 CCATCTCTACAATAAATAAATGG - Intronic
1182734298 22:32520305-32520327 CCATCTCTACAAAAAAAAAAAGG - Intronic
1183203354 22:36401481-36401503 CCATCTCTACTAACATTACCCGG - Intergenic
1183209112 22:36439503-36439525 CCGTCTCTACTAAAAATACTGGG + Intergenic
1183574581 22:38679507-38679529 CCATCTCTATTAAAAATAGCCGG + Intergenic
1183969382 22:41465331-41465353 CCGTCTCTACTAAAAATACGTGG - Intronic
1184750027 22:46480000-46480022 CCATCTGTTCTACAAAAACCAGG + Intronic
1184958404 22:47908988-47909010 CCATCTCTACTAAAAATACAAGG - Intergenic
1185390025 22:50554820-50554842 CTGTCTCTATTAAAAATACAAGG + Intronic
949738970 3:7208001-7208023 GCAGCTGTACTAAATATAGAAGG - Intronic
950075283 3:10182579-10182601 CCATCTCTACTAAAAATACAAGG - Intronic
951118926 3:18900168-18900190 CCATCTCTACTAAAAATACAAGG + Intergenic
952790295 3:37195135-37195157 CTATCTCTCCTAAAAATAAAAGG - Intergenic
953103224 3:39850597-39850619 CCATTTGTTCTCAAAATAAAGGG - Intronic
953559700 3:43977389-43977411 CCGTCTCTACTAAAAATGCCGGG - Intergenic
954190588 3:48957479-48957501 CCATCTGTAGTGAAAAAAGACGG + Intronic
954666053 3:52253039-52253061 CCATCTCTACTAAAAATATTGGG - Intergenic
955324190 3:57997083-57997105 CCATCTCTACAAAAAGTACAGGG - Intergenic
955451903 3:59077499-59077521 CCGTCTCTTCTAAAAATACATGG + Intergenic
955853744 3:63250304-63250326 ACATGTCAACTAAAAATACAAGG + Intronic
956365644 3:68499348-68499370 CCCTCTCTACTAAGAATTCAAGG - Intronic
956768980 3:72508390-72508412 CCGTCTCTACTAAAAATAGCCGG + Intergenic
956841199 3:73141945-73141967 CCGTCTCTACTAAAAATAGCCGG - Intergenic
957806052 3:85150728-85150750 CCGTCTCTACTAAAAAAAAAAGG + Intronic
960562654 3:119102210-119102232 CCATCTGCTATAAAAATTCATGG + Intronic
960589696 3:119353630-119353652 CTGTCTCTACTAAAAATACATGG + Intronic
961250707 3:125502696-125502718 CCATCTCTACTAAAACTACATGG + Intronic
961257105 3:125565071-125565093 CCATCTCTACAAAAACTAAAAGG + Intronic
962559276 3:136589059-136589081 CCATGTCTATTAAAAATACAAGG - Intronic
962783191 3:138740812-138740834 CCATCTGTACAAAAATTACCTGG - Intronic
963704596 3:148670242-148670264 CCATCTCTACTAAAAACACAGGG - Intergenic
964136826 3:153353680-153353702 CTGTCTATACTAAAAATACAGGG + Intergenic
964399860 3:156287654-156287676 CTATCTCTACTAAAAATACAAGG + Intronic
964758517 3:160111073-160111095 CTGTCTCTACTAAAAATACCTGG - Intergenic
964970902 3:162559468-162559490 CTATGTGTAGTAAAAATAAAGGG - Intergenic
966712465 3:182983543-182983565 CCATCTCTACTAAAATTAACCGG + Intronic
966788440 3:183641320-183641342 CCGTCTCTACTAAAAATACATGG + Intronic
966801679 3:183769855-183769877 TCATCTCTACTAAAATTACAAGG - Intronic
967059076 3:185855432-185855454 TCATCTCTACAAAAAATACAAGG + Intergenic
968159736 3:196416267-196416289 CCATCTCTACAAAAATTACCCGG + Intronic
968388962 4:172881-172903 CCGTCTCTACTAAAATTAGATGG + Intergenic
968814762 4:2816208-2816230 CCATTTCTACTAAAAATACCAGG - Intronic
969122739 4:4921862-4921884 CCGTCTCTACTAAAAATACATGG - Intergenic
970557837 4:17253575-17253597 CCATCTCTACTAAAAATACAAGG + Intergenic
970596106 4:17601800-17601822 GCATCAGTACTGAACATACACGG - Intronic
971291913 4:25350437-25350459 CTGTCTCTACTAAAAATACAGGG - Intronic
971292105 4:25352584-25352606 CTGTCTCTACTAAAAATACAGGG - Intronic
971690291 4:29825382-29825404 CTGTCTCTACTAAAAATATAAGG - Intergenic
973093221 4:46164389-46164411 CCGTCTCTACTAAAAATACAAGG - Intergenic
974043278 4:56876313-56876335 CCATCTCTACTAAATATACAAGG + Intergenic
974051165 4:56943323-56943345 CTATTTGTAATAAAAATAAATGG - Intergenic
975261749 4:72310714-72310736 CCATCTGCTATTAAAATACAAGG - Intronic
975442706 4:74431223-74431245 ACATGTGTGCTAAAATTACATGG - Intergenic
975915099 4:79315362-79315384 CCATCTGAAATAAAAATAATGGG - Intronic
976729845 4:88250731-88250753 CAGTCTTTACTAAAAATACAAGG - Intergenic
976742941 4:88375962-88375984 CCATCTTTACAAAAAATAGCTGG - Intergenic
976755719 4:88495731-88495753 CTAACTGTACTAATAAGACAAGG + Intronic
977891796 4:102320932-102320954 CAATCTGTAGTATAACTACATGG - Intronic
978099984 4:104826742-104826764 CTTTCTGTAGTAAAAATACCTGG - Intergenic
978678128 4:111343504-111343526 TCATCTGTACTGAATATAAAGGG + Intergenic
978897314 4:113904423-113904445 TCTTAAGTACTAAAAATACAAGG + Intronic
979268267 4:118729002-118729024 GCATCTGTACTGAAAAGGCATGG + Intronic
979718050 4:123865452-123865474 AGATCTCTACTAAAAATAAAAGG - Intergenic
980280834 4:130717117-130717139 CTCTCTGTATTAAAATTACAAGG - Intergenic
980444143 4:132884871-132884893 CCATCTGAAAAAAAAACACAGGG - Intergenic
980939009 4:139254964-139254986 CCGTCTCTACTAAAAATACAAGG - Intergenic
982654853 4:158135158-158135180 CCATCTCTACTAAAGATACCGGG + Intronic
983674792 4:170280013-170280035 CCAAGTGCAATAAAAATACAGGG + Intergenic
985250928 4:188023578-188023600 CCATCTCTACTAAAACTACGTGG + Intergenic
985616392 5:924684-924706 CTGTCTCTACTAAAAATAAAAGG - Intergenic
985998559 5:3612022-3612044 CTGTCTCTACTAAAAATACATGG - Intergenic
987338390 5:16917685-16917707 CCATCTCTACAAAAAAAAAAAGG + Intronic
987941788 5:24548288-24548310 CCATCTCTACTAAAAATACATGG - Intronic
989062223 5:37420599-37420621 CCATCTGTACAAAAAATAGCTGG - Intronic
991131950 5:63132655-63132677 GCATCTATACTAAAAATTCAGGG - Intergenic
991258025 5:64637121-64637143 CCATTTGTACTGAAAAGAAATGG - Intergenic
992714002 5:79491259-79491281 CCATCTCTACAAAAAATAGCCGG + Intronic
993301011 5:86210160-86210182 TCATCTTTAATAAAAACACAGGG + Intergenic
994822028 5:104665312-104665334 GTATCTGTACTAAACATATACGG - Intergenic
995463010 5:112421908-112421930 TTGTCTCTACTAAAAATACAGGG - Intergenic
996582703 5:125049086-125049108 CCATCTCTACAAAAAATAGCTGG - Intergenic
996981699 5:129503666-129503688 CCATCTCTACTAAAAATATGTGG + Intronic
997327823 5:133036610-133036632 CTGTCTCTATTAAAAATACAGGG + Intergenic
997946668 5:138208953-138208975 ATATCTGTACTAGAAATACATGG - Intronic
997966171 5:138358151-138358173 CCATCTCTACTAAAATTACATGG - Intronic
998117226 5:139547384-139547406 GCGTCTCTACTAAAAATACATGG - Intronic
998437435 5:142124168-142124190 CCATCAGTACTAGAAATATTTGG + Intronic
998682563 5:144486601-144486623 CTTTCTGTACAAGAAATACAAGG - Intergenic
998824312 5:146085245-146085267 CCATCTCTACTAAAATAATATGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999534078 5:152498401-152498423 CCATATGTACTATATATGCATGG - Intergenic
999536731 5:152525641-152525663 CCTTCTCTACTAAAATCACAGGG + Intergenic
1001184017 5:169549853-169549875 CCATATGTTCTAAAAATGCATGG - Intergenic
1001281114 5:170387126-170387148 CCATTTCTACCAAAAATACCAGG + Intronic
1002593853 5:180309580-180309602 CCATCTCTACTAAAAATAGCTGG - Intronic
1002715830 5:181226574-181226596 CAATCTCTGCTAAAAATGCAGGG - Intronic
1003088203 6:3078321-3078343 CCCTCTCTACAAAAAATAAAAGG + Intronic
1004321946 6:14638834-14638856 GCATCTCTTCTAAAAATACGAGG - Intergenic
1004366278 6:15015650-15015672 CCATTTCTACTAAAAATACATGG - Intergenic
1004372176 6:15062056-15062078 CCATCTCTACAAAAAATAACAGG - Intergenic
1004414043 6:15408091-15408113 CCATCTCTACAAAAAATACAAGG + Intronic
1004676629 6:17849071-17849093 CCATCTCTACTAAAAAGGCACGG - Intronic
1005485470 6:26295188-26295210 CCATCTCTACTAAAAATGCAAGG - Intergenic
1005595906 6:27379112-27379134 ACAGCTGTGCTAAAACTACAAGG + Intronic
1005750187 6:28875015-28875037 CCATCTCTACTAAAAATACCTGG + Intergenic
1005761782 6:28974137-28974159 CCATCTCTACTAAAAATACATGG - Intergenic
1006476124 6:34255334-34255356 CCGTCTTTACTAAAAATAGCCGG + Intergenic
1006483077 6:34314250-34314272 CCATCTCTACTGAAAATATAAGG + Intronic
1007190716 6:40015451-40015473 CCATCTCTACTAAAAATATTTGG - Intergenic
1007362670 6:41370094-41370116 CCATCTTTACAAAAACTAAAAGG - Intergenic
1007576999 6:42931529-42931551 CCGTCTCTACTAAAAATAGCCGG - Intronic
1008182717 6:48352763-48352785 CCATCTGTACCAAATACAGAAGG - Intergenic
1008319468 6:50090287-50090309 CCATCTTCATTAAAAGTACAAGG + Intergenic
1008637127 6:53421920-53421942 CCATCTCTACTAAAAATAGTAGG - Intergenic
1008672510 6:53785826-53785848 CCATCTCTACTAAAAATACATGG - Intergenic
1009242156 6:61196561-61196583 CCATCTCTACTAAAAATACAAGG - Intergenic
1010026093 6:71219034-71219056 ACTTCTGTACTTAAAATAGAGGG + Intergenic
1010072281 6:71757861-71757883 ACATGTGTACAAAAAGTACAAGG + Intergenic
1010693040 6:78933287-78933309 CCATCTCTAATAAAAGTGCAAGG - Intronic
1012863883 6:104595062-104595084 TCATCTCTACAAAAAATACAGGG + Intergenic
1013042220 6:106447049-106447071 ACATCTGTGCTAAAAAGAAAAGG + Intergenic
1013522774 6:110947977-110947999 CCATCTCCACTAAAAATAGCTGG + Intergenic
1014858153 6:126428777-126428799 CCAACTTTACAAAAAAAACAAGG - Intergenic
1015468284 6:133573322-133573344 CAATCCGTTCTAAAAATATAGGG - Intergenic
1015818927 6:137239444-137239466 CCATCTCTACAAAAAATAGCTGG + Intergenic
1015975221 6:138783736-138783758 TCATCTCTATAAAAAATACAAGG - Intronic
1016164802 6:140927459-140927481 CCATCTGTACAAAAAGAAGAAGG + Intergenic
1016166256 6:140948100-140948122 CCATCTGTTTGAAAAATATAAGG + Intergenic
1017951953 6:159142457-159142479 CCATATGCACTATAAGTACAGGG + Intergenic
1018018432 6:159733741-159733763 CCGTCTCTACTAAAAATACAAGG + Intronic
1019926034 7:4192445-4192467 CTGTCTCTACTAAAAATACAAGG - Intronic
1020072416 7:5235881-5235903 CCGTCTCTACTAAAAATACATGG + Intergenic
1020182309 7:5931826-5931848 CCCCATCTACTAAAAATACAAGG + Intronic
1020300601 7:6792931-6792953 CCCCATCTACTAAAAATACAAGG - Intronic
1020790759 7:12625749-12625771 GCATCTTTACCTAAAATACAAGG - Exonic
1021748259 7:23766422-23766444 CCATCTCTACTAAAATTAGCCGG - Intronic
1021860448 7:24900796-24900818 CCATCTTTACAAAAAATATTAGG + Intronic
1021897295 7:25249451-25249473 CTGTCTCTACTAAAAATGCATGG - Intergenic
1022454720 7:30548195-30548217 CCATCTGTCCCAAAATTTCAGGG + Intronic
1022459032 7:30586677-30586699 CCGTCTCTACTAAAAATACATGG + Intergenic
1022988666 7:35685806-35685828 TCATCTCTACTAAAAATACGTGG + Intronic
1023427064 7:40049031-40049053 CCATCTCTACTAAAAATAGCTGG + Intronic
1023486319 7:40690988-40691010 CCATCTGGACGAAATATACTTGG + Intronic
1024070164 7:45777947-45777969 CCATCTATACAAAAAATAGCCGG - Intergenic
1024284562 7:47746079-47746101 CCACCTGTAGTAAAAAGACCTGG + Intronic
1025608565 7:63057111-63057133 CCATCTCTACTAAAAAGAAAAGG - Intergenic
1025610014 7:63069912-63069934 CCGTCTCTACTAAAAATAGCTGG - Intergenic
1026680540 7:72463320-72463342 CCATCTGTACTAAAAGTACCTGG - Intergenic
1027170840 7:75871177-75871199 CCGTCTCTACTAAAAATACATGG + Intronic
1028126819 7:87122559-87122581 ACATCAGTAATAAAAATAAAAGG + Intergenic
1029118163 7:98248669-98248691 CCATCTTTACTGAAAAAAAAAGG + Intronic
1029264936 7:99331231-99331253 CCATCTCTACAAAAATTACCTGG + Intronic
1029265484 7:99336124-99336146 GCATCTGTATTAAAAATAATTGG - Intronic
1029835897 7:103309454-103309476 GCATCTGTACTAAACATGTATGG + Intronic
1030150060 7:106395355-106395377 CCATCTCTACTTAAAAAAAATGG + Intergenic
1030649131 7:112098077-112098099 TCATATGCACTAAAAATGCAAGG + Intronic
1030649486 7:112102002-112102024 CCATCTCTACTAAAATTAGCTGG - Intronic
1031132898 7:117853571-117853593 CCATGTGATCTGAAAATACAAGG - Intronic
1031758855 7:125684124-125684146 ACATATAGACTAAAAATACAGGG + Intergenic
1032241961 7:130169064-130169086 CCGTCTCTACCAAAAATACCCGG + Intronic
1032345742 7:131114773-131114795 CCATCTCTACTAAAATTAGCCGG + Intronic
1032357209 7:131222065-131222087 CCATCTCTACTAAAATTAGCCGG - Intronic
1032529777 7:132610487-132610509 CCATCCCTGCTAAAAATAAAAGG + Intronic
1033180805 7:139175987-139176009 CTGTCTCTACTAAAAATACCGGG - Intronic
1033198510 7:139348205-139348227 CCATCTCTATTAAAAAAAAAAGG - Intronic
1033364032 7:140657834-140657856 CTGTCTCTACTAAAAATACTCGG + Intronic
1034068572 7:148160493-148160515 ACACCTGTACAAAAAATACCAGG - Intronic
1034519122 7:151605185-151605207 CCGTCTCTACTAAAAATACAAGG - Intronic
1034726709 7:153343033-153343055 CCAATTGTTCTAAAAATCCAGGG - Intergenic
1035123339 7:156588147-156588169 CCATATGTAGCAAAAATATAAGG + Intergenic
1036110014 8:5888011-5888033 CTGTCTCTACTAAAAATACCCGG - Intergenic
1036450169 8:8859180-8859202 CCGTCTCTACAAAAATTACATGG + Intronic
1037231182 8:16660713-16660735 CCATGTATTCTAAAGATACATGG + Intergenic
1037252542 8:16913358-16913380 CCATCACTCCTAAAGATACAAGG - Intergenic
1037489014 8:19378872-19378894 CCATCTCTACAAAAAAAACATGG + Intronic
1037681820 8:21103995-21104017 CCTTCTCTACTAAAAATGCCAGG + Intergenic
1038285134 8:26199627-26199649 CCATCTCTACTAAAATTAGCTGG - Intergenic
1038796412 8:30714369-30714391 CTGTCTCTACTAAAAATACCAGG - Intronic
1039607354 8:38892516-38892538 CTGTCTCTACTAAAAATACATGG - Intergenic
1041046882 8:53895815-53895837 CTATTTCTACTAAAAATACAAGG - Intronic
1041252696 8:55949554-55949576 CCATGTCAACTAAAAATAAAAGG - Intronic
1042392227 8:68249112-68249134 CTGTCTCTACTAAAAATACTGGG - Intergenic
1044007111 8:86951416-86951438 CCATCTCTACTAAAAGTAGCTGG + Intronic
1044602769 8:94022202-94022224 CCGTCTCTACTAAAAATACAAGG + Intergenic
1044617028 8:94152835-94152857 CCTTCTCTACTAAAAATAAAAGG - Intronic
1045365909 8:101475990-101476012 CCATCTCTACTAAAAATACTGGG + Intergenic
1045613110 8:103871236-103871258 CCATCTGTACTAAAAATATGCGG + Intronic
1046551398 8:115722621-115722643 CTGTCTCTTCTAAAAATACAAGG - Intronic
1047485109 8:125322886-125322908 CCATCTCTACTAAAAATACAAGG + Intronic
1047917754 8:129600980-129601002 CAATTTCTACTAAAAATACAAGG - Intergenic
1048147828 8:131862738-131862760 CCGTCTCTACTAAAAATACTGGG + Intergenic
1049214153 8:141400067-141400089 CCATCTCTACAAAAAATAGCTGG - Intronic
1050886849 9:10777582-10777604 CCATCTCTATTAAAACAACATGG - Intergenic
1051109277 9:13617088-13617110 CCATCTCTACAAAAAAGGCAGGG - Intergenic
1051227688 9:14919401-14919423 ACATCTGTGGTAAAAATAAAAGG + Intergenic
1052124451 9:24757581-24757603 CCATCTTTACTTACAAAACAGGG - Intergenic
1052162112 9:25275560-25275582 CTATATGTACTTCAAATACAAGG + Intergenic
1052972776 9:34387169-34387191 CCATCTCTATGAAAAATACCAGG - Intronic
1053445294 9:38148365-38148387 CCATCTCTACCAAAAAAAGAAGG - Intergenic
1053484389 9:38441132-38441154 CCATCTCTACAAAAAATAAAAGG - Intergenic
1053520729 9:38776088-38776110 GCATCTGAACAAAAAATTCAGGG + Intergenic
1053670014 9:40351332-40351354 CCATCTGTTCTAAGAATGCTGGG - Intergenic
1053919805 9:42977582-42977604 CCATCTGTTCTAAGAATGCTGGG - Intergenic
1054192885 9:62000081-62000103 GCATCTGAACAAAAAATTCAGGG + Intergenic
1054381137 9:64491331-64491353 CCATCTGTTCTAAGAATGCTGGG - Intergenic
1054514599 9:66024965-66024987 CCATCTGTTCTAAGAATGCTGGG + Intergenic
1054645522 9:67588610-67588632 GCATCTGAACAAAAAATTCAGGG - Intergenic
1054735788 9:68748780-68748802 CCGTCTCTACTAAAAATAGCAGG - Intronic
1055105869 9:72512234-72512256 CCATCTCTACTAAAAATACCAGG + Intergenic
1055147304 9:72951738-72951760 CCATTTGTAGTAAAACTAAATGG + Intronic
1055469617 9:76598284-76598306 CCATCTCTACTAAAAGGACAAGG + Intergenic
1055930129 9:81551665-81551687 CAATCTGTACAAATAATAAAAGG + Intergenic
1056164674 9:83929612-83929634 CCATCTCTACTAAAAATACTGGG - Intergenic
1056292013 9:85153175-85153197 CCATCTCTACTAAAAATAAAAGG - Intergenic
1057086298 9:92213971-92213993 CCATCTCTACTAAAATTAGCTGG - Intronic
1059100297 9:111465011-111465033 CCGTCTCTACTAAAAATACAAGG + Intronic
1059209402 9:112498623-112498645 CCATCTCAACTAAAAATAAAAGG - Intronic
1060395028 9:123310179-123310201 CCATCTCTACTAAAAATACAAGG - Intergenic
1060604699 9:124903315-124903337 CTATCTCTGCTAAAAATACAAGG + Intronic
1061316630 9:129800352-129800374 CCGTCTCTACTAAAAACAGATGG + Intergenic
1061928172 9:133817480-133817502 CCATCTCTACTAAAAATACTCGG + Intronic
1062125748 9:134861160-134861182 CCATCTCTACTAAAAATACATGG + Intergenic
1062458554 9:136652988-136653010 CCATCTCTACTAAAATTAGCCGG + Intergenic
1062530845 9:136999200-136999222 CTGTCTCTACTACAAATACAAGG - Intergenic
1062539831 9:137036615-137036637 CCATCTCCACTAAAAATAGCTGG + Exonic
1185578564 X:1192982-1193004 CCATCTCTACTAAAAATACAAGG - Intronic
1186493884 X:9996635-9996657 GCATCTGTGCTGAACATACACGG + Intergenic
1186804438 X:13126064-13126086 CTGTCTCTACTAAAAATACATGG - Intergenic
1187950072 X:24462945-24462967 CCACATGTAATATAAATACAAGG - Intergenic
1189126662 X:38455016-38455038 CTATATGTACTAGAAGTACAAGG - Intronic
1189400249 X:40661380-40661402 CTATCTCTACTGAAAATACAAGG - Intronic
1189427638 X:40915670-40915692 CCATCTCTACTAAAAATACCAGG - Intergenic
1189543895 X:42021774-42021796 CCATCTCTACTAAAAATAAAAGG - Intergenic
1190003035 X:46707908-46707930 CCTTCTCTACTAAAAATACAAGG - Intronic
1190086384 X:47398840-47398862 CTGTCTCTACTAAAAATACTGGG - Intronic
1190389746 X:49920330-49920352 CCATCTCTACTAAAAATACATGG - Intergenic
1190676751 X:52789250-52789272 CCGTCTCTACCAAAAATACCTGG - Intronic
1190885161 X:54525205-54525227 CCGTCTCTACTAAAAATACACGG + Intergenic
1195879945 X:109582231-109582253 CCATCTGAACTAAAATAACACGG + Intergenic
1196010658 X:110884230-110884252 CCAGCTATACTATATATACAAGG - Intergenic
1196667265 X:118329841-118329863 CCATCTCTACTAAAAATAGCCGG - Intergenic
1196695946 X:118611913-118611935 CTGTCTCTACTAAAAATACTGGG - Intronic
1196709341 X:118746283-118746305 CCATCTGTACAAAAAAAAATTGG - Intronic
1196908728 X:120464911-120464933 CCATCTCTACTAAAAATACAAGG - Intronic
1198471200 X:136948765-136948787 CCATCTCTACTAAAAATACGGGG - Intergenic
1198522425 X:137466360-137466382 TTATCTGGACCAAAAATACAAGG - Intergenic
1198889273 X:141374800-141374822 CCATCAGAAATAAAAATAGAAGG - Intergenic
1199149468 X:144413518-144413540 ACATATATACTAAAAATAAAGGG - Intergenic