ID: 1109629342

View in Genome Browser
Species Human (GRCh38)
Location 13:65024170-65024192
Sequence CTTTCAGCAGAAACTCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109629342_1109629346 -2 Left 1109629342 13:65024170-65024192 CCTTGTAGAGTTTCTGCTGAAAG No data
Right 1109629346 13:65024191-65024213 AGGTACACTGTTAGCCTGGTGGG No data
1109629342_1109629344 -6 Left 1109629342 13:65024170-65024192 CCTTGTAGAGTTTCTGCTGAAAG No data
Right 1109629344 13:65024187-65024209 TGAAAGGTACACTGTTAGCCTGG No data
1109629342_1109629345 -3 Left 1109629342 13:65024170-65024192 CCTTGTAGAGTTTCTGCTGAAAG No data
Right 1109629345 13:65024190-65024212 AAGGTACACTGTTAGCCTGGTGG No data
1109629342_1109629348 12 Left 1109629342 13:65024170-65024192 CCTTGTAGAGTTTCTGCTGAAAG No data
Right 1109629348 13:65024205-65024227 CCTGGTGGGATTGCCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109629342 Original CRISPR CTTTCAGCAGAAACTCTACA AGG (reversed) Intergenic
No off target data available for this crispr