ID: 1109641652

View in Genome Browser
Species Human (GRCh38)
Location 13:65199524-65199546
Sequence CTGTGAAGTAAGAGCTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109641652_1109641654 -8 Left 1109641652 13:65199524-65199546 CCATGATAGCTCTTACTTCACAG No data
Right 1109641654 13:65199539-65199561 CTTCACAGGCCAGTTGAAACTGG No data
1109641652_1109641658 20 Left 1109641652 13:65199524-65199546 CCATGATAGCTCTTACTTCACAG No data
Right 1109641658 13:65199567-65199589 TCCTCCACTTGAGTGTGGGTAGG No data
1109641652_1109641657 16 Left 1109641652 13:65199524-65199546 CCATGATAGCTCTTACTTCACAG No data
Right 1109641657 13:65199563-65199585 AATATCCTCCACTTGAGTGTGGG No data
1109641652_1109641656 15 Left 1109641652 13:65199524-65199546 CCATGATAGCTCTTACTTCACAG No data
Right 1109641656 13:65199562-65199584 CAATATCCTCCACTTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109641652 Original CRISPR CTGTGAAGTAAGAGCTATCA TGG (reversed) Intergenic
No off target data available for this crispr