ID: 1109646742

View in Genome Browser
Species Human (GRCh38)
Location 13:65268468-65268490
Sequence CTTAACATGCAGAATTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109646742_1109646743 -5 Left 1109646742 13:65268468-65268490 CCTTATAAATTCTGCATGTTAAG No data
Right 1109646743 13:65268486-65268508 TTAAGCCTTTGTCAGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109646742 Original CRISPR CTTAACATGCAGAATTTATA AGG (reversed) Intergenic
No off target data available for this crispr