ID: 1109665081

View in Genome Browser
Species Human (GRCh38)
Location 13:65523935-65523957
Sequence AAAAATAGACTTCACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109665078_1109665081 17 Left 1109665078 13:65523895-65523917 CCAGAAAGCACTAAAATAAGTAA No data
Right 1109665081 13:65523935-65523957 AAAAATAGACTTCACTTGGGAGG No data
1109665077_1109665081 18 Left 1109665077 13:65523894-65523916 CCCAGAAAGCACTAAAATAAGTA No data
Right 1109665081 13:65523935-65523957 AAAAATAGACTTCACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109665081 Original CRISPR AAAAATAGACTTCACTTGGG AGG Intergenic
No off target data available for this crispr