ID: 1109667856

View in Genome Browser
Species Human (GRCh38)
Location 13:65562782-65562804
Sequence CCTTAAATACAGAGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109667856_1109667861 5 Left 1109667856 13:65562782-65562804 CCAATTTCCCTCTGTATTTAAGG No data
Right 1109667861 13:65562810-65562832 TGGCTTTCCTTAAGATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109667856 Original CRISPR CCTTAAATACAGAGGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr