ID: 1109683571

View in Genome Browser
Species Human (GRCh38)
Location 13:65784301-65784323
Sequence TGGGCACTAAGGAGCGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109683571_1109683584 6 Left 1109683571 13:65784301-65784323 CCTCCGGCGCTCCTTAGTGCCCA No data
Right 1109683584 13:65784330-65784352 GAGGGGGCCGAGGCAGCAAGGGG No data
1109683571_1109683585 10 Left 1109683571 13:65784301-65784323 CCTCCGGCGCTCCTTAGTGCCCA No data
Right 1109683585 13:65784334-65784356 GGGCCGAGGCAGCAAGGGGCTGG No data
1109683571_1109683583 5 Left 1109683571 13:65784301-65784323 CCTCCGGCGCTCCTTAGTGCCCA No data
Right 1109683583 13:65784329-65784351 GGAGGGGGCCGAGGCAGCAAGGG No data
1109683571_1109683578 -10 Left 1109683571 13:65784301-65784323 CCTCCGGCGCTCCTTAGTGCCCA No data
Right 1109683578 13:65784314-65784336 TTAGTGCCCAAGTCTGGAGGGGG No data
1109683571_1109683586 11 Left 1109683571 13:65784301-65784323 CCTCCGGCGCTCCTTAGTGCCCA No data
Right 1109683586 13:65784335-65784357 GGCCGAGGCAGCAAGGGGCTGGG No data
1109683571_1109683582 4 Left 1109683571 13:65784301-65784323 CCTCCGGCGCTCCTTAGTGCCCA No data
Right 1109683582 13:65784328-65784350 TGGAGGGGGCCGAGGCAGCAAGG No data
1109683571_1109683587 12 Left 1109683571 13:65784301-65784323 CCTCCGGCGCTCCTTAGTGCCCA No data
Right 1109683587 13:65784336-65784358 GCCGAGGCAGCAAGGGGCTGGGG No data
1109683571_1109683580 -4 Left 1109683571 13:65784301-65784323 CCTCCGGCGCTCCTTAGTGCCCA No data
Right 1109683580 13:65784320-65784342 CCCAAGTCTGGAGGGGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109683571 Original CRISPR TGGGCACTAAGGAGCGCCGG AGG (reversed) Intergenic
No off target data available for this crispr