ID: 1109684462

View in Genome Browser
Species Human (GRCh38)
Location 13:65797717-65797739
Sequence CTGATTATACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109684460_1109684462 -2 Left 1109684460 13:65797696-65797718 CCTTAGCTTCAAGGTGGAAGACT No data
Right 1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109684462 Original CRISPR CTGATTATACAAATGGACAA TGG Intergenic
No off target data available for this crispr