ID: 1109690570

View in Genome Browser
Species Human (GRCh38)
Location 13:65882627-65882649
Sequence AAGGGATGTTTCGAAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109690570_1109690574 -3 Left 1109690570 13:65882627-65882649 CCCTCAGCTTCGAAACATCCCTT No data
Right 1109690574 13:65882647-65882669 CTTCTCTACTCTGCTGCGTGAGG No data
1109690570_1109690578 12 Left 1109690570 13:65882627-65882649 CCCTCAGCTTCGAAACATCCCTT No data
Right 1109690578 13:65882662-65882684 GCGTGAGGTGAGGCTAGGGCTGG No data
1109690570_1109690577 8 Left 1109690570 13:65882627-65882649 CCCTCAGCTTCGAAACATCCCTT No data
Right 1109690577 13:65882658-65882680 TGCTGCGTGAGGTGAGGCTAGGG No data
1109690570_1109690575 2 Left 1109690570 13:65882627-65882649 CCCTCAGCTTCGAAACATCCCTT No data
Right 1109690575 13:65882652-65882674 CTACTCTGCTGCGTGAGGTGAGG No data
1109690570_1109690580 14 Left 1109690570 13:65882627-65882649 CCCTCAGCTTCGAAACATCCCTT No data
Right 1109690580 13:65882664-65882686 GTGAGGTGAGGCTAGGGCTGGGG No data
1109690570_1109690579 13 Left 1109690570 13:65882627-65882649 CCCTCAGCTTCGAAACATCCCTT No data
Right 1109690579 13:65882663-65882685 CGTGAGGTGAGGCTAGGGCTGGG No data
1109690570_1109690576 7 Left 1109690570 13:65882627-65882649 CCCTCAGCTTCGAAACATCCCTT No data
Right 1109690576 13:65882657-65882679 CTGCTGCGTGAGGTGAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109690570 Original CRISPR AAGGGATGTTTCGAAGCTGA GGG (reversed) Intergenic
No off target data available for this crispr