ID: 1109692311

View in Genome Browser
Species Human (GRCh38)
Location 13:65909674-65909696
Sequence CAGAGTAAACAGATGATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109692311_1109692314 -5 Left 1109692311 13:65909674-65909696 CCAAGCATCATCTGTTTACTCTG No data
Right 1109692314 13:65909692-65909714 CTCTGGGAGTTTTGCCCCAGAGG No data
1109692311_1109692318 17 Left 1109692311 13:65909674-65909696 CCAAGCATCATCTGTTTACTCTG No data
Right 1109692318 13:65909714-65909736 GAATGCAGAGCTGCCAGTGCTGG No data
1109692311_1109692319 28 Left 1109692311 13:65909674-65909696 CCAAGCATCATCTGTTTACTCTG No data
Right 1109692319 13:65909725-65909747 TGCCAGTGCTGGCAGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109692311 Original CRISPR CAGAGTAAACAGATGATGCT TGG (reversed) Intergenic
No off target data available for this crispr