ID: 1109705869

View in Genome Browser
Species Human (GRCh38)
Location 13:66092282-66092304
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109705869_1109705875 3 Left 1109705869 13:66092282-66092304 CCTGCTCTGCCCCACATCCTATG No data
Right 1109705875 13:66092308-66092330 ATAAAAACCCCAGACTCAGCTGG 0: 11
1: 48
2: 87
3: 156
4: 413
1109705869_1109705879 18 Left 1109705869 13:66092282-66092304 CCTGCTCTGCCCCACATCCTATG No data
Right 1109705879 13:66092323-66092345 TCAGCTGGTAGACATGACTATGG No data
1109705869_1109705881 29 Left 1109705869 13:66092282-66092304 CCTGCTCTGCCCCACATCCTATG No data
Right 1109705881 13:66092334-66092356 ACATGACTATGGCTGGACGTTGG No data
1109705869_1109705880 22 Left 1109705869 13:66092282-66092304 CCTGCTCTGCCCCACATCCTATG No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109705869 Original CRISPR CATAGGATGTGGGGCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr