ID: 1109705872

View in Genome Browser
Species Human (GRCh38)
Location 13:66092293-66092315
Sequence GTTTTTATAGGCATAGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109705872_1109705880 11 Left 1109705872 13:66092293-66092315 CCACATCCTATGCCTATAAAAAC No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data
1109705872_1109705881 18 Left 1109705872 13:66092293-66092315 CCACATCCTATGCCTATAAAAAC No data
Right 1109705881 13:66092334-66092356 ACATGACTATGGCTGGACGTTGG No data
1109705872_1109705882 28 Left 1109705872 13:66092293-66092315 CCACATCCTATGCCTATAAAAAC No data
Right 1109705882 13:66092344-66092366 GGCTGGACGTTGGCAAGAAGTGG No data
1109705872_1109705879 7 Left 1109705872 13:66092293-66092315 CCACATCCTATGCCTATAAAAAC No data
Right 1109705879 13:66092323-66092345 TCAGCTGGTAGACATGACTATGG No data
1109705872_1109705875 -8 Left 1109705872 13:66092293-66092315 CCACATCCTATGCCTATAAAAAC No data
Right 1109705875 13:66092308-66092330 ATAAAAACCCCAGACTCAGCTGG 0: 11
1: 48
2: 87
3: 156
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109705872 Original CRISPR GTTTTTATAGGCATAGGATG TGG (reversed) Intergenic
No off target data available for this crispr