ID: 1109705873

View in Genome Browser
Species Human (GRCh38)
Location 13:66092299-66092321
Sequence TCTGGGGTTTTTATAGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109705873_1109705880 5 Left 1109705873 13:66092299-66092321 CCTATGCCTATAAAAACCCCAGA No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data
1109705873_1109705882 22 Left 1109705873 13:66092299-66092321 CCTATGCCTATAAAAACCCCAGA No data
Right 1109705882 13:66092344-66092366 GGCTGGACGTTGGCAAGAAGTGG No data
1109705873_1109705879 1 Left 1109705873 13:66092299-66092321 CCTATGCCTATAAAAACCCCAGA No data
Right 1109705879 13:66092323-66092345 TCAGCTGGTAGACATGACTATGG No data
1109705873_1109705881 12 Left 1109705873 13:66092299-66092321 CCTATGCCTATAAAAACCCCAGA No data
Right 1109705881 13:66092334-66092356 ACATGACTATGGCTGGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109705873 Original CRISPR TCTGGGGTTTTTATAGGCAT AGG (reversed) Intergenic
No off target data available for this crispr