ID: 1109705880

View in Genome Browser
Species Human (GRCh38)
Location 13:66092327-66092349
Sequence CTGGTAGACATGACTATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109705868_1109705880 29 Left 1109705868 13:66092275-66092297 CCAATGGCCTGCTCTGCCCCACA No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data
1109705869_1109705880 22 Left 1109705869 13:66092282-66092304 CCTGCTCTGCCCCACATCCTATG No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data
1109705870_1109705880 13 Left 1109705870 13:66092291-66092313 CCCCACATCCTATGCCTATAAAA No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data
1109705874_1109705880 -1 Left 1109705874 13:66092305-66092327 CCTATAAAAACCCCAGACTCAGC 0: 107
1: 253
2: 459
3: 490
4: 697
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data
1109705872_1109705880 11 Left 1109705872 13:66092293-66092315 CCACATCCTATGCCTATAAAAAC No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data
1109705871_1109705880 12 Left 1109705871 13:66092292-66092314 CCCACATCCTATGCCTATAAAAA No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data
1109705873_1109705880 5 Left 1109705873 13:66092299-66092321 CCTATGCCTATAAAAACCCCAGA No data
Right 1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109705880 Original CRISPR CTGGTAGACATGACTATGGC TGG Intergenic
No off target data available for this crispr