ID: 1109709947

View in Genome Browser
Species Human (GRCh38)
Location 13:66146533-66146555
Sequence CAGAGCAAAAAGGAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109709943_1109709947 4 Left 1109709943 13:66146506-66146528 CCTGAGGTCATGGGTGGATCTTT 0: 2
1: 160
2: 377
3: 226
4: 236
Right 1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109709947 Original CRISPR CAGAGCAAAAAGGAGGAGGA CGG Intergenic
No off target data available for this crispr