ID: 1109710575

View in Genome Browser
Species Human (GRCh38)
Location 13:66153418-66153440
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109710567_1109710575 25 Left 1109710567 13:66153370-66153392 CCATCTGGGATGAATTTAATGAG No data
Right 1109710575 13:66153418-66153440 CTTAGGAAGTGGAAGTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109710575 Original CRISPR CTTAGGAAGTGGAAGTGGAA AGG Intergenic
No off target data available for this crispr