ID: 1109712165

View in Genome Browser
Species Human (GRCh38)
Location 13:66176128-66176150
Sequence CTTTATATGTATATAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109712162_1109712165 -7 Left 1109712162 13:66176112-66176134 CCTACGTATATATCTGCTTTATA No data
Right 1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG No data
1109712161_1109712165 10 Left 1109712161 13:66176095-66176117 CCAATTAATTGCACATACCTACG No data
Right 1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109712165 Original CRISPR CTTTATATGTATATAAAGGA GGG Intergenic
No off target data available for this crispr