ID: 1109712683

View in Genome Browser
Species Human (GRCh38)
Location 13:66180849-66180871
Sequence AGTTTTCTACAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109712680_1109712683 15 Left 1109712680 13:66180811-66180833 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG No data
1109712681_1109712683 4 Left 1109712681 13:66180822-66180844 CCAAGAGCTGTCTCTAAAAATCA No data
Right 1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG No data
1109712679_1109712683 16 Left 1109712679 13:66180810-66180832 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109712683 Original CRISPR AGTTTTCTACAGAAGATGGC AGG Intergenic
No off target data available for this crispr