ID: 1109714532

View in Genome Browser
Species Human (GRCh38)
Location 13:66204352-66204374
Sequence TTGGAGATGAATAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109714532_1109714537 0 Left 1109714532 13:66204352-66204374 CCAACTTCCTTATTCATCTCCAA No data
Right 1109714537 13:66204375-66204397 AAGGCAAAAACTCACATGCTGGG No data
1109714532_1109714538 7 Left 1109714532 13:66204352-66204374 CCAACTTCCTTATTCATCTCCAA No data
Right 1109714538 13:66204382-66204404 AAACTCACATGCTGGGCCTCAGG No data
1109714532_1109714539 10 Left 1109714532 13:66204352-66204374 CCAACTTCCTTATTCATCTCCAA No data
Right 1109714539 13:66204385-66204407 CTCACATGCTGGGCCTCAGGTGG No data
1109714532_1109714536 -1 Left 1109714532 13:66204352-66204374 CCAACTTCCTTATTCATCTCCAA No data
Right 1109714536 13:66204374-66204396 AAAGGCAAAAACTCACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109714532 Original CRISPR TTGGAGATGAATAAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr