ID: 1109719869

View in Genome Browser
Species Human (GRCh38)
Location 13:66261765-66261787
Sequence CTGGAAAGAGACAGACTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109719869_1109719872 29 Left 1109719869 13:66261765-66261787 CCAACAAGTCTGTCTCTTTCCAG No data
Right 1109719872 13:66261817-66261839 CTTTTCCCTTGAGATACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109719869 Original CRISPR CTGGAAAGAGACAGACTTGT TGG (reversed) Intergenic
No off target data available for this crispr